National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5520R-1 
 Symbol Gp93  Full Name Glycoprotein 93 
 CG No CG5520  Old CG No CG5520 
 Synonyms CT17486, gp93, CG5520, p93, Gp93 
 Accession No (Link to NCBI) NM_143344.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Maynard JC, Pham T, Zheng T, Jockheck-Clark A, Rankin HB, Newgard CB, Spana EP, Nicchitta CV.
Gp93, the Drosophila GRP94 ortholog, is required for gut epithelial homeostasis and nutrient assimilation-coupled growth control.
Dev. Biol. (2010) 339(2) 295-306 [ PubMed ID = 20044986 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CTGCTCCTAGCAGGCATCAATCAAATAGCCGCCGATGACGAGGCCGCCACAACGGAGACC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATCGACCTTGATCTGGGCTCCTTCAAGGAGGGCTCCCGCACCGATGCCGAGACCCTGAAG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGCGAGGAGGAGGCCATCCAGCTGGACGGCCTGAACGTGGCGCAGCTGAAGGAAATTCGC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAGAAGGCGAAGAAGTTTACTTTCCAAACGGAGGTCAACCGCATGATGAAGCTGATTATC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AACTCGCTTTACCGCAACAAGGAGATCTTCCTGCGTGAATTGATATCCAACGCCTCCGAT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCCATCGACAAGATCCGCCTATTGGCTCTGTCCAACAGCAAGGAGCTGGAAACGAATCCG 360

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAGCTGCACATCCGCATTAAGGCCGACAAGGAGAACAAGGCGTTGCACATCATGGACTC- 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGGTATCGGCATGACTCACCAGGATCTGATCAATAACCTGGGTACAATTGCCAAGTCCGG 480

5520R-1.IR_full       481 CACTGCCGATTTTTCTGGCCAA 502
                          ||||||||| |||||||||||| silico     481 CACTGCCGA-TTTTCTGGCCAA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143344.2  CG5520-RA (Gp93), mRNA 
0.2   NM_134917.2  CG15406-RA (CG15406), mRNA 
0   NM_170466.1  CG31025-RA, transcript variant A (CG31025), mRNA 
0   NM_170467.1  CG31025-RB, transcript variant B (CG31025), mRNA 
0   NM_164431.1  CG17654-RB, transcript variant B (Eno), mRNA 
0   NM_164434.1  CG17654-RE, transcript variant E (Eno), mRNA 
0   NM_164432.1  CG17654-RC, transcript variant C (Eno), mRNA 
0   NM_164433.1  CG17654-RD, transcript variant D (Eno), mRNA 
0   NM_058073.3  CG17654-RA, transcript variant A (Eno), mRNA 
0   19  41  NM_079175.2  CG1242-RA (Hsp83), mRNA 
0   NM_167635.1  CG7088-RD, transcript variant D (bnb), mRNA 
0   NM_167633.1  CG7088-RA, transcript variant A (bnb), mRNA 
0   NM_078682.2  CG7088-RC, transcript variant C (bnb), mRNA 
0   NM_167634.1  CG7088-RB, transcript variant B (bnb), mRNA 
0   NM_176121.1  CG33183-RC, transcript variant C (Hr46), mRNA 
0   NM_176123.1  CG33183-RA, transcript variant A (Hr46), mRNA 
0   NM_176122.1  CG33183-RB, transcript variant B (Hr46), mRNA 
0   NM_165102.1  CG4170-RD, transcript variant D (vig), mRNA 
0   NM_165101.1  CG4170-RC, transcript variant C (vig), mRNA 
0   NM_078848.2  CG4170-RA, transcript variant A (vig), mRNA 
0   NM_165100.1  CG4170-RB, transcript variant B (vig), mRNA 
0   NM_137143.1  CG12857-RA (CG12857), mRNA 
0   14  NM_167505.1  CG4211-RB, transcript variant B (nonA), mRNA 
0   14  NM_001014747.1  CG4211-RC, transcript variant C (nonA), mRNA 
0   14  NM_078643.2  CG4211-RA, transcript variant A (nonA), mRNA 
0   11  NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   NM_166429.1  CG9433-RA, transcript variant A (Xpd), mRNA 
0   NM_057830.3  CG9433-RB, transcript variant B (Xpd), mRNA 
0   NM_170641.1  CG32464-RF, transcript variant F (l(3)82Fd), mRNA 
0   NM_001031978.1  CG32464-RM, transcript variant M (l(3)82Fd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.