National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5486R-3 
 Symbol Ubp64E  Full Name Ubiquitin-specific protease 64E 
 CG No CG5486  Old CG No CG5486 
 Synonyms Ubp64, UBP, D-UBP-64E, D-Ubp-64E, E(var)3-64E, E-var(3)64E, E(var)1, CG5486, BcDNA:LD12764, Ubp64E 
 Accession No (Link to NCBI) NM_168129.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Ashton-Beaucage D, Lemieux C, Udell CM, Sahmi M, Rochette S, Therrien M.
The Deubiquitinase USP47 Stabilizes MAPK by Counteracting the Function of the N-end Rule ligase POE/UBR4 in Drosophila.
PLoS Biol. (2016) 14(8) e1002539 [ PubMed ID = 27552662 ] [ RRC reference ]

Zhang J, Liu M, Su Y, Du J, Zhu AJ.
A targeted in vivo RNAi screen reveals deubiquitinases as new regulators of Notch signaling.
G3 (Bethesda) (2012) 2(12) 1563-75 [ PubMed ID = 23275879 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTAGATATCCCGCTCCCTGTG 
 Primer Seq. 3'
aatctagaggtaccTGCTTGGCGCTCTTGCTGGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTAGATATCC CGCTCCCTGT GAGGCCCTTT GGAAGCAGCT CCGCATACGG CAGCATCGAG 
0061 GAAGCTCTGC GTGCCTTCGT TCAGCCGGAA ACACTCGATG GCAATAACCA GTATCTGTGC 
0121 GAGAAGTGCA AGAAAAAATG CGACGCCCAC AAGGGACTGC ACTTTAAGTC CTTTCCCTAC 
0181 ATCCTCACGC TGCACCTTAA ACGCTTCGAC TTTGACTACC AGACCATGCA CCGCATCAAA 
0241 TTAAACGACA GAGTGACCTT CCCTCAGACG CTCAACCTGA ACACGTTCAT TAACCGAAGT 
0301 GGAAACAGCG GTGAGCAAAA CTCTCAGCTC AACGGCACCG TGGACGATTG CAGCACGGCG 
0361 GATAGTGGAT CCGCCATGGA GGACGATAAT TTGAGCAGCG GCGTGGTGAC CACAGCGAGC 
0421 TCTAGTCAGC ACGAAAACGA TCTGAACGAC GAGGATGAAG GCATCGACAT GAGCAGCAGC 
0481 ACCAGCAAGA GCGCCAAGCA  
 in silico PCR Fragment
0001 CTAGATATCC CGCTCCCTGT GAGGCCCTTT GGAAGCAGCT CCGCATACGG CAGCATCGAG 
0061 GAAGCTCTGC GTGCCTTCGT TCAGCCCGAA ACACTCGATG GCAATAACCA GTATCTGTGC 
0121 GAGAAGTGCA AGAAAAAATG CGACGCCCAC AAGGGACTGC ACTTTAAGTC CTTTCCCTAC 
0181 ATCCTCACGC TGCACCTTAA ACGCTTTGAC TTTGACTACC AGACCATGCA CCGCATCAAA 
0241 TTAAACGACA GAGTGACCTT CCCTCAGACG CTCAACCTGA ACACGTTCAT TAACCGAAGT 
0301 GGAAACAGCG GTGAGCAAAA CTCTCAGCTC AACGGCACCG TGGACGATTG CAGCACGGCG 
0361 GATAGTGGAT CCGCCATGGA GGACGATAAT TTGAGCAGCG GCGTGGTGAC CACAGCGAGC 
0421 TCTAGTCAGC ACGAAAACGA TCTGAACGAC GAGGATGAAG GCATCGACAT GAGCAGCAGC 
0481 ACCAGCAAGA GCGCCAAGCA  
 Assemble Data

5486R-3.IR_full       1   CTAGATATCCCGCTCCCTGTGAGGCCCTTTGGAAGCAGCTCCGCATACGGCAGCATCGAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5486R-3.in silico     1   CTAGATATCCCGCTCCCTGTGAGGCCCTTTGGAAGCAGCTCCGCATACGGCAGCATCGAG 60


5486R-3.IR_full       61  GAAGCTCTGCGTGCCTTCGTTCAGCCGGAAACACTCGATGGCAATAACCAGTATCTGTGC 120
                          |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
5486R-3.in silico     61  GAAGCTCTGCGTGCCTTCGTTCAGCCCGAAACACTCGATGGCAATAACCAGTATCTGTGC 120


5486R-3.IR_full       121 GAGAAGTGCAAGAAAAAATGCGACGCCCACAAGGGACTGCACTTTAAGTCCTTTCCCTAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5486R-3.in silico     121 GAGAAGTGCAAGAAAAAATGCGACGCCCACAAGGGACTGCACTTTAAGTCCTTTCCCTAC 180


5486R-3.IR_full       181 ATCCTCACGCTGCACCTTAAACGCTTCGACTTTGACTACCAGACCATGCACCGCATCAAA 240
                          |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
5486R-3.in silico     181 ATCCTCACGCTGCACCTTAAACGCTTTGACTTTGACTACCAGACCATGCACCGCATCAAA 240


5486R-3.IR_full       241 TTAAACGACAGAGTGACCTTCCCTCAGACGCTCAACCTGAACACGTTCATTAACCGAAGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5486R-3.in silico     241 TTAAACGACAGAGTGACCTTCCCTCAGACGCTCAACCTGAACACGTTCATTAACCGAAGT 300


5486R-3.IR_full       301 GGAAACAGCGGTGAGCAAAACTCTCAGCTCAACGGCACCGTGGACGATTGCAGCACGGCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5486R-3.in silico     301 GGAAACAGCGGTGAGCAAAACTCTCAGCTCAACGGCACCGTGGACGATTGCAGCACGGCG 360


5486R-3.IR_full       361 GATAGTGGATCCGCCATGGAGGACGATAATTTGAGCAGCGGCGTGGTGACCACAGCGAGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5486R-3.in silico     361 GATAGTGGATCCGCCATGGAGGACGATAATTTGAGCAGCGGCGTGGTGACCACAGCGAGC 420


5486R-3.IR_full       421 TCTAGTCAGCACGAAAACGATCTGAACGACGAGGATGAAGGCATCGACATGAGCAGCAGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5486R-3.in silico     421 TCTAGTCAGCACGAAAACGATCTGAACGACGAGGATGAAGGCATCGACATGAGCAGCAGC 480


5486R-3.IR_full       481 ACCAGCAAGAGCGCCAAGCA 500
                          ||||||||||||||||||||
5486R-3.in silico     481 ACCAGCAAGAGCGCCAAGCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168129.1  CG5486-RA, transcript variant A (Ubp64E), mRNA 
100   482  NM_206279.1  CG5486-RC, transcript variant C (Ubp64E), mRNA 
100   482  NM_079213.2  CG5486-RB, transcript variant B (Ubp64E), mRNA 
0   NM_142878.2  CG6755-RB, transcript variant B (EloA), mRNA 
0   NM_170061.1  CG6755-RA, transcript variant A (EloA), mRNA 
0   12  76  NM_001038965.1  CG9924-RE, transcript variant E (CG9924), mRNA 
0   11  124  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   24  NM_167279.1  CG18361-RB, transcript variant B (dsh), mRNA 
0   24  NM_078563.2  CG18361-RA, transcript variant A (dsh), mRNA 
0   17  NM_057982.3  CG2819-RA (Pph13), mRNA 
0   NM_079725.2  CG7050-RA (Nrx-1), mRNA 
0   NM_001038849.1  CG11763-RD, transcript variant D (micr), mRNA 
0   NM_165770.1  CG11763-RA, transcript variant A (micr), mRNA 
0   NM_130687.1  CG14422-RA (CG14422), mRNA 
0   NM_136741.2  CG11763-RC, transcript variant C (micr), mRNA 
0   NM_144205.1  CG7796-RA (CG7796), mRNA 
0   72  NM_079853.2  CG15532-RA, transcript variant A (hdc), mRNA 
0   72  NM_176591.1  CG15532-RC, transcript variant C (hdc), mRNA 
0   23  NM_164726.1  CG31908-RA, transcript variant A (CG31908), mRNA 
0   23  NM_164727.1  CG31908-RB, transcript variant B (CG31908), mRNA 
0   NM_143422.1  CG11898-RA (CG11898), mRNA 
0   46  NM_001031911.1  CG33670-RA (CG33670), mRNA 
0   46  NM_001031910.1  CG11566-RA (CG11566), mRNA 
0   25  NM_057265.3  CG1264-RA (lab), mRNA 
0   NM_132967.1  CG5004-RA (CG5004), mRNA 
0   15  NM_206053.1  CG18654-RD, transcript variant D (Dgk), mRNA 
0   15  NM_078930.2  CG18654-RA, transcript variant A (Dgk), mRNA 
0   15  NM_165568.1  CG18654-RB, transcript variant B (Dgk), mRNA 
0   NM_001038966.1  CG33967-RA (CG33967), mRNA 
0   NM_139588.3  CG12605-RB, transcript variant B (CG12605), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.