National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5485R-3 
 Symbol Prestin  Full Name Prestin 
 CG No CG5485  Old CG No CG5485 
 Synonyms dpres, CG5485, Prestin 
 Accession No (Link to NCBI) NM_140767.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Hirata T, Cabrero P, Berkholz DS, Bondeson DP, Ritman EL, Thompson JR, Dow JA, Romero MF.
In vivo Drosophilia genetic model for calcium oxalate nephrolithiasis.
Am. J. Physiol. Renal Physiol. (2012) 303(11) F1555-62 [ PubMed ID = 22993075 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTACAAATGGAAACGGTGGCAG 
 Primer Seq. 3'
aatctagaggtaccAACCGAAGGCGTTAATAGGCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TACAAATGGA AACGGTGGCA GTGTACCAAG CAAGCCAAAG ATCCAGCCAA AATATAGCAT 
0061 TCACCGAGAT GTGCTGACCC ATGAGGTGGT GATAAAGCAA ACAGGATATG CGGCCAGGGA 
0121 CAAGAGCATA CCCTCCTCGC TGCGAAACTG CTGGCGGAGC TGGNAACTTC TTTGCACTCT 
0181 TCACCGGCGT GATTCCCATT CTGCAATGGC TACCCCAGTA TTCACCCAGG AGAGATCTTC 
0241 CTGGCGATAT ANATCGCCGG CTTCACCGTC GCCATCATGA ACATACCTCA TGGCATGGCN 
0301 TTATGGCATT CTAGCAGGAG TTTCGGCTGG AAATGGTCTC TATATGGCCG TGTTTCCGGT 
0361 GCTGGCCTAC ATGTTCCTGG GGACCTCCAA GCACATCTCC ATCGGCACCT TTGCGGTGGC 
0421 CAGCATGATG ACGGCAAAGG TGGTGGATAC GTATGCCAAC GTAGATGACC ACCATCAGAT 
0481 ATTGCCTATT AACGCCTTCG GTT 
 in silico PCR Fragment
0001 TACAAATGGA AACGGTGGCA GTGTACCAAG CAAGCCAAAG ATCCAGCCAA AATATAGCAT 
0061 TCACCGAGAT GTGCTGACCC ATGAGGTGGT GATAAAGCAA ACAGGATATG CGGCCAGGGA 
0121 CAAGAGCATA CCCTCCTCGC TGCGAAACTG CTGGCGGAGC TGG-AACTTC TTTGCACTCT 
0181 TCACCGGCGT GATTCCCATT CTGCAATGGC TACCCCAGTA TTCACCCAGG AGAGATCTTC 
0241 CTGGCGATAT A-ATCGCCGG CTTCACCGTC GCCATCATGA ACATACCTCA TGGCATGGC- 
0301 TTATGGCATT CTAGCAGGAG TTTCGGCTGG AAATGGTCTC TATATGGCCG TGTTTCCGGT 
0361 GCTGGCCTAC ATGTTCCTGG GGACCTCCAA GCACATCTCC ATCGGCACTT TTGCGGTGGC 
0421 CAGCATGATG ACGGCAAAGG TGGTGGATAC GTATGCCAAC GTAGATGACC ACCATCAGAT 
0481 ATTGCCTATT AACGCCTTCG GTT 
 Assemble Data

5485R-3.IR_full       1   TACAAATGGAAACGGTGGCAGTGTACCAAGCAAGCCAAAGATCCAGCCAAAATATAGCAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5485R-3.in silico     1   TACAAATGGAAACGGTGGCAGTGTACCAAGCAAGCCAAAGATCCAGCCAAAATATAGCAT 60


5485R-3.IR_full       61  TCACCGAGATGTGCTGACCCATGAGGTGGTGATAAAGCAAACAGGATATGCGGCCAGGGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5485R-3.in silico     61  TCACCGAGATGTGCTGACCCATGAGGTGGTGATAAAGCAAACAGGATATGCGGCCAGGGA 120


5485R-3.IR_full       121 CAAGAGCATACCCTCCTCGCTGCGAAACTGCTGGCGGAGCTGGNAACTTCTTTGCACTCT 180
                          ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
5485R-3.in silico     121 CAAGAGCATACCCTCCTCGCTGCGAAACTGCTGGCGGAGCTGG-AACTTCTTTGCACTCT 180


5485R-3.IR_full       181 TCACCGGCGTGATTCCCATTCTGCAATGGCTACCCCAGTATTCACCCAGGAGAGATCTTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5485R-3.in silico     181 TCACCGGCGTGATTCCCATTCTGCAATGGCTACCCCAGTATTCACCCAGGAGAGATCTTC 240


5485R-3.IR_full       241 CTGGCGATATANATCGCCGGCTTCACCGTCGCCATCATGAACATACCTCATGGCATGGCN 300
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| 
5485R-3.in silico     241 CTGGCGATATA-ATCGCCGGCTTCACCGTCGCCATCATGAACATACCTCATGGCATGGC- 300


5485R-3.IR_full       301 TTATGGCATTCTAGCAGGAGTTTCGGCTGGAAATGGTCTCTATATGGCCGTGTTTCCGGT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5485R-3.in silico     301 TTATGGCATTCTAGCAGGAGTTTCGGCTGGAAATGGTCTCTATATGGCCGTGTTTCCGGT 360


5485R-3.IR_full       361 GCTGGCCTACATGTTCCTGGGGACCTCCAAGCACATCTCCATCGGCACCTTTGCGGTGGC 420
                          |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
5485R-3.in silico     361 GCTGGCCTACATGTTCCTGGGGACCTCCAAGCACATCTCCATCGGCACTTTTGCGGTGGC 420


5485R-3.IR_full       421 CAGCATGATGACGGCAAAGGTGGTGGATACGTATGCCAACGTAGATGACCACCATCAGAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5485R-3.in silico     421 CAGCATGATGACGGCAAAGGTGGTGGATACGTATGCCAACGTAGATGACCACCATCAGAT 480


5485R-3.IR_full       481 ATTGCCTATTAACGCCTTCGGTT 503
                          |||||||||||||||||||||||
5485R-3.in silico     481 ATTGCCTATTAACGCCTTCGGTT 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140767.1  CG5485-RA (Prestin), mRNA 
0   16  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   11  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_134789.1  CG15356-RA (CG15356), mRNA 
0   NM_166402.1  CG30147-RB, transcript variant B (Hil), mRNA 
0   NM_137649.2  CG30147-RA, transcript variant A (Hil), mRNA 
0   NM_137226.2  CG8314-RA (CG8314), mRNA 
0   NM_080152.2  CG5092-RA (Tor), mRNA 
0   NM_137809.1  CG3292-RA (CG3292), mRNA 
0   NM_130657.2  CG13762-RA (CG13762), mRNA 
0   NM_137251.2  CG8443-RA (CG8443), mRNA 
0   NM_166742.1  CG31998-RA (CG31998), mRNA 
0   NM_136448.2  CG2144-RA (CG2144), mRNA 
0   NM_164987.1  CG14945-RB, transcript variant B (CG14945), mRNA 
0   NM_135697.1  CG14945-RA, transcript variant A (CG14945), mRNA 
0   NM_176479.1  CG4381-RA (GstD3), mRNA 
0   NM_166941.1  CG32796-RA, transcript variant A (CG32796), mRNA 
0   NM_166940.1  CG32796-RB, transcript variant B (CG32796), mRNA 
0   14  NM_165881.1  CG8487-RA, transcript variant A (garz), mRNA 
0   14  NM_136917.2  CG8487-RB, transcript variant B (garz), mRNA 
0   NM_167535.1  CG9676-RA (CG9676), mRNA 
0   NM_175955.1  CG33122-RA (cutlet), mRNA 
0   NM_206265.1  CG12008-RC, transcript variant C (kst), mRNA 
0   NM_206266.1  CG12008-RB, transcript variant B (kst), mRNA 
0   NM_079176.1  CG12008-RA, transcript variant A (kst), mRNA 
0   NM_138084.2  CG13585-RA, transcript variant A (CG13585), mRNA 
0   NM_166676.1  CG13585-RB, transcript variant B (CG13585), mRNA 
0   18  NM_141738.3  CG6303-RA (Bruce), mRNA 
0   15  NM_132457.1  CG11122-RA (CG11122), mRNA 
0   12  NM_137979.2  CG13560-RA (CG13560), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.