National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5476R-3 
 Symbol CG5476  Full Name CG5476 
 CG No CG5476  Old CG No CG5476 
 Synonyms BcDNA:RE59605, BcDNA:RE20092, CG5476 
 Accession No (Link to NCBI) NM_170281.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kobayashi M, Michaut L, Ino A, Honjo K, Nakajima T, Maruyama Y, Mochizuki H, Ando M, Ghangrekar I, Takahashi K, Saigo K, Ueda R, Gehring WJ, Furukubo-Tokunaga K.
Differential microarray analysis of Drosophila mushroom body transcripts using chemical ablation.
Proc. Natl. Acad. Sci. U.S.A. (2006) 103(39) 14417-22 [ PubMed ID = 16971484 ] [ RRC reference ]

Kamimura K, Koyama T, Habuchi H, Ueda R, Masu M, Kimata K, Nakato H.
Specific and flexible roles of heparan sulfate modifications in Drosophila FGF signaling.
J. Cell Biol. (2006) 174(6) 773-8 [ PubMed ID = 16966419 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTCGTCGTCCTGTGCCTGGTG 
 Primer Seq. 3'
aatctagaggtaccCTGGCAACGCGTTCCAATGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTCGTCGTCC TGTGCCTGGT GGcCATCGCC TCCGCCGACA AGCTCGGCTA CAACTACAAG 
0061 CCCGTGGGCC ACTNCCAGCT CCGGACTCTC CTTCGCTCCT GGCAGCGGAT CCCTCAGCCT 
0121 GGGAGGCGGC GGTGGATCCT TGGGCCTGGG TGGCAGCAGC GGATCCTTGG ATCTGGGAGG 
0181 AGCCAGTGGA TCCCTCGGCC TGGGAGGCGG CAGCAACTTC GGCAGCTTGG ACGGCGGCTT 
0241 TGGCGGTCTT GGCGGTGGCT CCATCGATCT GGGATCCTCC GGCCTGGGTT CCTCCGGTCT 
0301 TGGATCTGGA TTGGGATCAT CTGGTCTTGG ATCTGGCCTG GGCTCCTCCG GCTTGGGATC 
0361 TGGTCTGGGA TCCGCTGGAC TGAGCGCCCC CGTCTCCTAC AATGCCCCCG CCCCTGCTGC 
0421 TGAGCTCCAG AAGGAGTTCT TCACCTACAC CGCTAACGAG GAGGACTTCG ATGAGCCCCA 
0481 AGCATTGGAA CGCGTTGCCA G 
 in silico PCR Fragment
0001 TTCGTCGTCC TGTGCCTGGT GGCCATCGCC TCCGCCGACA AGCTCGGCTA CAACTACAAG 
0061 CCCGTGGGCC ACT-CCAGCT CCGGACTCTC CTTCGCTCCT GGCAGCGGAT CCCTCAGCCT 
0121 GGGAGGCGGC GGTGGATCCT TGGGCCTGGG TGGCAGCAGC GGATCCTTGG ATCTGGGAGG 
0181 AGCCAGTGGA TCCCTCGGCC TGGGAGGCGG CAGCAACTTC GGCAGCTTGG ACGGCGGCTT 
0241 TGGCGGTCTT GGCGGTGGCT CCATCGATCT GGGATCCTCC GGCCTGGGTT CCTCCGGTCT 
0301 TGGATCTGGA TTGGGATCAT CTGGTCTTGG ATCTGGCCTG GGCTCCTCCG GCTTGGGATC 
0361 TGGTCTGGGA TCCGCTGGAC TGAGCGCCCC CGTCTCCTAC AATGCCCCCG CCCCTGCTGC 
0421 TGAGCTCCAG AAGGAGTTCT TCACCTACAC CGCTAACGAG GAGGACTTCG ATGAGCCCCA 
0481 AGCATTGGAA CGCGTTGCCA G 
 Assemble Data

5476R-3.IR_full       1   TTCGTCGTCCTGTGCCTGGTGGCCATCGCCTCCGCCGACAAGCTCGGCTACAACTACAAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5476R-3.in silico     1   TTCGTCGTCCTGTGCCTGGTGGCCATCGCCTCCGCCGACAAGCTCGGCTACAACTACAAG 60


5476R-3.IR_full       61  CCCGTGGGCCACTNCCAGCTCCGGACTCTCCTTCGCTCCTGGCAGCGGATCCCTCAGCCT 120
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
5476R-3.in silico     61  CCCGTGGGCCACT-CCAGCTCCGGACTCTCCTTCGCTCCTGGCAGCGGATCCCTCAGCCT 120


5476R-3.IR_full       121 GGGAGGCGGCGGTGGATCCTTGGGCCTGGGTGGCAGCAGCGGATCCTTGGATCTGGGAGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5476R-3.in silico     121 GGGAGGCGGCGGTGGATCCTTGGGCCTGGGTGGCAGCAGCGGATCCTTGGATCTGGGAGG 180


5476R-3.IR_full       181 AGCCAGTGGATCCCTCGGCCTGGGAGGCGGCAGCAACTTCGGCAGCTTGGACGGCGGCTT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5476R-3.in silico     181 AGCCAGTGGATCCCTCGGCCTGGGAGGCGGCAGCAACTTCGGCAGCTTGGACGGCGGCTT 240


5476R-3.IR_full       241 TGGCGGTCTTGGCGGTGGCTCCATCGATCTGGGATCCTCCGGCCTGGGTTCCTCCGGTCT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5476R-3.in silico     241 TGGCGGTCTTGGCGGTGGCTCCATCGATCTGGGATCCTCCGGCCTGGGTTCCTCCGGTCT 300


5476R-3.IR_full       301 TGGATCTGGATTGGGATCATCTGGTCTTGGATCTGGCCTGGGCTCCTCCGGCTTGGGATC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5476R-3.in silico     301 TGGATCTGGATTGGGATCATCTGGTCTTGGATCTGGCCTGGGCTCCTCCGGCTTGGGATC 360


5476R-3.IR_full       361 TGGTCTGGGATCCGCTGGACTGAGCGCCCCCGTCTCCTACAATGCCCCCGCCCCTGCTGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5476R-3.in silico     361 TGGTCTGGGATCCGCTGGACTGAGCGCCCCCGTCTCCTACAATGCCCCCGCCCCTGCTGC 420


5476R-3.IR_full       421 TGAGCTCCAGAAGGAGTTCTTCACCTACACCGCTAACGAGGAGGACTTCGATGAGCCCCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5476R-3.in silico     421 TGAGCTCCAGAAGGAGTTCTTCACCTACACCGCTAACGAGGAGGACTTCGATGAGCCCCA 480


5476R-3.IR_full       481 AGCATTGGAACGCGTTGCCAG 501
                          |||||||||||||||||||||
5476R-3.in silico     481 AGCATTGGAACGCGTTGCCAG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  12  30  104  NM_170281.1  CG5476-RA (CG5476), mRNA 
3.11   15  51  60  49  NM_170279.2  CG6447-RA, transcript variant A (CG6447), mRNA 
3.11   15  51  59  44  NM_170280.1  CG6447-RB, transcript variant B (CG6447), mRNA 
1.24   71  54  50  NM_143229.1  CG6478-RA (CG6478), mRNA 
0.62   NM_169530.1  CG9412-RC, transcript variant C (rin), mRNA 
0.62   NM_169532.1  CG9412-RE, transcript variant E (rin), mRNA 
0.62   NM_169533.1  CG9412-RA, transcript variant A (rin), mRNA 
0.62   NM_080168.2  CG9412-RB, transcript variant B (rin), mRNA 
0.62   NM_169531.1  CG9412-RD, transcript variant D (rin), mRNA 
0.2   56  58  42  NM_143227.1  CG5468-RA (CG5468), mRNA 
0.2   NM_140744.1  CG6064-RA (TORC), mRNA 
0.2   NM_001043193.1  CG14638-RB, transcript variant B (CG14638), mRNA 
0.2   NM_141185.1  CG14638-RA, transcript variant A (CG14638), mRNA 
0   11  22  NM_143233.2  CG31080-RA (CG31080), mRNA 
0   13  NM_143237.2  CG5480-RA (CG5480), mRNA 
0   29  NM_143232.1  CG5471-RA (CG5471), mRNA 
0   NM_165542.1  CG1363-RA (blow), mRNA 
0   NM_135948.2  CG5809-RA (CaBP1), mRNA 
0   NM_138161.1  CG13875-RA (CG13875), mRNA 
0   NM_165540.2  CG2140-RA, transcript variant A (Cyt-b5), mRNA 
0   NM_136450.2  CG2140-RB, transcript variant B (Cyt-b5), mRNA 
0   NM_165582.1  CG8722-RB, transcript variant B (Nup44A), mRNA 
0   NM_165583.1  CG8722-RC, transcript variant C (Nup44A), mRNA 
0   NM_136499.2  CG8722-RA, transcript variant A (Nup44A), mRNA 
0   NM_136596.2  CG13747-RA (CG13747), mRNA 
0   10  NM_136355.1  CG14593-RA (CG14593), mRNA 
0   NM_206685.1  CG1743-RA, transcript variant A (Gs2), mRNA 
0   NM_078568.2  CG1743-RC, transcript variant C (Gs2), mRNA 
0   NM_167284.1  CG1743-RB, transcript variant B (Gs2), mRNA 
0   10  NM_176717.1  CG9113-RC, transcript variant C (AP-1gamma), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
DC
++ 
DM
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
++ 
DM
VM
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.