National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5476R-2 
 Symbol CG5476  Full Name CG5476 
 CG No CG5476  Old CG No CG5476 
 Synonyms BcDNA:RE59605, BcDNA:RE20092, CG5476 
 Accession No (Link to NCBI) NM_170281.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Kobayashi M, Michaut L, Ino A, Honjo K, Nakajima T, Maruyama Y, Mochizuki H, Ando M, Ghangrekar I, Takahashi K, Saigo K, Ueda R, Gehring WJ, Furukubo-Tokunaga K.
Differential microarray analysis of Drosophila mushroom body transcripts using chemical ablation.
Proc. Natl. Acad. Sci. U.S.A. (2006) 103(39) 14417-22 [ PubMed ID = 16971484 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TTCGTCGTCCTGTGCCTGGTGGCCATCGCCTCCGCCGACAAGCTCGGCTACAACTACAAG 60

                          ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCCGTGGGCCACT-CCAGCTCCGGACTCTCCTTCGCTCCTGGCAGCGGATCCCTCAGCCT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGGAGGCGGCGGTGGATCCTTGGGCCTGGGTGGCAGCAGCGGATCCTTGGATCTGGGAGG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGCCAGTGGATCCCTCGGCCTGGGAGGCGGCAGCAACTTCGGCAGCTTGGACGGCGGCTT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGGCGGTCTTGGCGGTGGCTCCATCGATCTGGGATCCTCCGGCCTGGGTTCCTCCGGTCT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGGATCTGGATTGGGATCATCTGGTCTTGGATCTGGCCTGGGCTCCTCCGGCTTGGGATC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGGTCTGGGATCCGCTGGACTGAGCGCCCCCGTCTCCTACAATGCCCCCGCCCCTGCTGC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGAGCTCCAGAAGGAGTTCTTCACCTACACCGCTAACGAGGAGGACTTCGATGAGCCCCA 480

5476R-2.IR_full       481 AGCATTGGAACGCGTTGCCAG 501
                          ||||||||||||||||||||| silico     481 AGCATTGGAACGCGTTGCCAG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  12  30  104  NM_170281.1  CG5476-RA (CG5476), mRNA 
3.11   15  51  60  49  NM_170279.2  CG6447-RA, transcript variant A (CG6447), mRNA 
3.11   15  51  59  44  NM_170280.1  CG6447-RB, transcript variant B (CG6447), mRNA 
1.24   71  54  50  NM_143229.1  CG6478-RA (CG6478), mRNA 
0.62   NM_169530.1  CG9412-RC, transcript variant C (rin), mRNA 
0.62   NM_169532.1  CG9412-RE, transcript variant E (rin), mRNA 
0.62   NM_169533.1  CG9412-RA, transcript variant A (rin), mRNA 
0.62   NM_080168.2  CG9412-RB, transcript variant B (rin), mRNA 
0.62   NM_169531.1  CG9412-RD, transcript variant D (rin), mRNA 
0.2   56  58  42  NM_143227.1  CG5468-RA (CG5468), mRNA 
0.2   NM_140744.1  CG6064-RA (TORC), mRNA 
0.2   NM_001043193.1  CG14638-RB, transcript variant B (CG14638), mRNA 
0.2   NM_141185.1  CG14638-RA, transcript variant A (CG14638), mRNA 
0   11  22  NM_143233.2  CG31080-RA (CG31080), mRNA 
0   13  NM_143237.2  CG5480-RA (CG5480), mRNA 
0   29  NM_143232.1  CG5471-RA (CG5471), mRNA 
0   NM_165542.1  CG1363-RA (blow), mRNA 
0   NM_135948.2  CG5809-RA (CaBP1), mRNA 
0   NM_138161.1  CG13875-RA (CG13875), mRNA 
0   NM_165540.2  CG2140-RA, transcript variant A (Cyt-b5), mRNA 
0   NM_136450.2  CG2140-RB, transcript variant B (Cyt-b5), mRNA 
0   NM_165582.1  CG8722-RB, transcript variant B (Nup44A), mRNA 
0   NM_165583.1  CG8722-RC, transcript variant C (Nup44A), mRNA 
0   NM_136499.2  CG8722-RA, transcript variant A (Nup44A), mRNA 
0   NM_136596.2  CG13747-RA (CG13747), mRNA 
0   10  NM_136355.1  CG14593-RA (CG14593), mRNA 
0   NM_206685.1  CG1743-RA, transcript variant A (Gs2), mRNA 
0   NM_078568.2  CG1743-RC, transcript variant C (Gs2), mRNA 
0   NM_167284.1  CG1743-RB, transcript variant B (Gs2), mRNA 
0   10  NM_176717.1  CG9113-RC, transcript variant C (AP-1gamma), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.