National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5475R-1 
 Symbol Mpk2  Full Name Mpk2 
 CG No CG5475  Old CG No CG5475 
 Synonyms p38 alpha, D-p38a, P38, D-p38, p38, p38a, Dp38, p38A, CG5475, D-P38a, D-MPK2, DmMPK2, dMPK2, DMPK2, group 2, Erk2, Mpk2 
 Accession No (Link to NCBI) NM_057815.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Gonda RL, Garlena RA, Stronach B.
Drosophila heat shock response requires the JNK pathway and phosphorylation of mixed lineage kinase at a conserved serine-proline motif.
PLoS ONE (2012) 7(7) e42369 [ PubMed ID = 22848763 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCGGGCACCTGAAATAATGCT 
 Primer Seq. 3'
aatctagaggtaccATACGATGGTGGGGGCTTAAA 
 Predicted Fragment Size
499 
 IR fragment full Seq
0001 CCGCGGACCT GAAATAATGC TCAATTGGAT GcNCTaCGac CAAACAGTGG ACATCTGGTC 
0061 GgtGGGCTGC ATCATGGCCG AACTAATTAC CAGACGAAcC CTCNTCCCAG GCACCGACCA 
0121 TATTCACCAG CTAAACCTGA TTATGGAGAT GTTGGGCACG CCACCCGCCG AATTTTTGAA 
0181 GAAGATCTCA TCGGAAAGTG CACGTTCCTA CATCCAGTCA CTTCCGCCTA TGAAGGGACG 
0241 AAGTTTTAAA AATGTTTTTA AGAACGCCAA TCCGCTGGCC ATTGATTTGC TGGAAAAGAT 
0301 GTTGGAGCTA GATGCCGAAA AGCGGATCAC AGCCGAGGAG GCTCTTTCCC ATCCATATCT 
0361 GGAGAAGTAT GCGGAGCCCA GCGTCGAGCA GACCTCACCA CCATACGATC ACAGCTTCGA 
0421 GGATATGGAT TTGCCCGTAG ACAAATGGAA GGAATTGATC TACAAGGAGG TCACCAACTT 
0481 TAAGCCCCCA CCATCGTAT 
 in silico PCR Fragment
0001 CCGGGCACCT GAAATAATGC TCAATTGGAT GCACTACGAC CAAACAGTGG ACATCTGGTC 
0061 GGTGGGCTGC ATCATGGCCG AACTAATTAC CAGACGAACC CTCTTCCCAG GCACCGACCA 
0121 TATTCACCAG CTAAACCTGA TTATGGAGAT GTTGGGCACG CCACCCGCCG AATTTTTGAA 
0181 GAAGATCTCA TCGGAAAGTG CACGTTCCTA CATCCAGTCA CTTCCGCCTA TGAAGGGACG 
0241 AAGTTTTAAA AATGTTTTTA AGAACGCCAA TCCGCTGGCC ATTGATTTGC TGGAAAAGAT 
0301 GTTGGAGCTA GATGCCGAAA AGCGGATCAC AGCCGAGGAG GCTCTTTCCC ATCCATATCT 
0361 GGAGAAGTAT GCGGAGCCCA GCGTCGAGCA GACCTCACCA CCATACGATC ACAGCTTCGA 
0421 GGATATGGAT TTGCCCGTAG ACAAATGGAA GGAATTGATC TACAAGGAGG TCACCAACTT 
0481 TAAGCCCCCA CCATCGTAT 
 Assemble Data

5475R-1.IR_full       1   CCGCGGACCTGAAATAATGCTCAATTGGATGCNCTACGACCAAACAGTGGACATCTGGTC 60
                          ||| | |||||||||||||||||||||||||| |||||||||||||||||||||||||||
5475R-1.in silico     1   CCGGGCACCTGAAATAATGCTCAATTGGATGCACTACGACCAAACAGTGGACATCTGGTC 60


5475R-1.IR_full       61  GGTGGGCTGCATCATGGCCGAACTAATTACCAGACGAACCCTCNTCCCAGGCACCGACCA 120
                          ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
5475R-1.in silico     61  GGTGGGCTGCATCATGGCCGAACTAATTACCAGACGAACCCTCTTCCCAGGCACCGACCA 120


5475R-1.IR_full       121 TATTCACCAGCTAAACCTGATTATGGAGATGTTGGGCACGCCACCCGCCGAATTTTTGAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5475R-1.in silico     121 TATTCACCAGCTAAACCTGATTATGGAGATGTTGGGCACGCCACCCGCCGAATTTTTGAA 180


5475R-1.IR_full       181 GAAGATCTCATCGGAAAGTGCACGTTCCTACATCCAGTCACTTCCGCCTATGAAGGGACG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5475R-1.in silico     181 GAAGATCTCATCGGAAAGTGCACGTTCCTACATCCAGTCACTTCCGCCTATGAAGGGACG 240


5475R-1.IR_full       241 AAGTTTTAAAAATGTTTTTAAGAACGCCAATCCGCTGGCCATTGATTTGCTGGAAAAGAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5475R-1.in silico     241 AAGTTTTAAAAATGTTTTTAAGAACGCCAATCCGCTGGCCATTGATTTGCTGGAAAAGAT 300


5475R-1.IR_full       301 GTTGGAGCTAGATGCCGAAAAGCGGATCACAGCCGAGGAGGCTCTTTCCCATCCATATCT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5475R-1.in silico     301 GTTGGAGCTAGATGCCGAAAAGCGGATCACAGCCGAGGAGGCTCTTTCCCATCCATATCT 360


5475R-1.IR_full       361 GGAGAAGTATGCGGAGCCCAGCGTCGAGCAGACCTCACCACCATACGATCACAGCTTCGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5475R-1.in silico     361 GGAGAAGTATGCGGAGCCCAGCGTCGAGCAGACCTCACCACCATACGATCACAGCTTCGA 420


5475R-1.IR_full       421 GGATATGGATTTGCCCGTAGACAAATGGAAGGAATTGATCTACAAGGAGGTCACCAACTT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5475R-1.in silico     421 GGATATGGATTTGCCCGTAGACAAATGGAAGGAATTGATCTACAAGGAGGTCACCAACTT 480


5475R-1.IR_full       481 TAAGCCCCCACCATCGTAT 499
                          |||||||||||||||||||
5475R-1.in silico     481 TAAGCCCCCACCATCGTAT 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_170126.2  CG5475-RB, transcript variant B (Mpk2), mRNA 
100   481  NM_057815.3  CG5475-RA, transcript variant A (Mpk2), mRNA 
2.49   12  19  32  37  NM_058013.3  CG7393-RA (p38b), mRNA 
0.2   NM_164876.1  CG31711-RA (CG31711), mRNA 
0.2   NM_167288.1  CG32666-RB, transcript variant B (CG32666), mRNA 
0.2   NM_206688.1  CG32666-RA, transcript variant A (CG32666), mRNA 
0   NM_144347.2  CG12149-RA (c12.2), mRNA 
0   11  NM_001015123.1  CG12559-PD.3 (CG12559), mRNA 
0   10  NM_001015170.1  CG40190-PA (CG40190), mRNA 
0   10  NM_001015122.1  CG12559-PC.3 (CG12559), mRNA 
0   10  NM_001015121.1  CG12559-PB.3 (CG12559), mRNA 
0   NM_165559.1  CG1891-RB, transcript variant B (sax), mRNA 
0   NM_078928.2  CG1891-RA, transcript variant A (sax), mRNA 
0   NM_169833.1  CG7717-RB, transcript variant B (Mekk1), mRNA 
0   NM_142493.2  CG7717-RA, transcript variant A (Mekk1), mRNA 
0   NM_058136.3  CG4376-RA, transcript variant A (Actn), mRNA 
0   NM_058137.3  CG4376-RC, transcript variant C (Actn), mRNA 
0   NM_166920.1  CG4376-RB, transcript variant B (Actn), mRNA 
0   NM_170435.1  CG31009-RA (Cad99C), mRNA 
0   11  NM_167366.1  CG1640-RC, transcript variant C (CG1640), mRNA 
0   11  NM_167367.1  CG1640-RD, transcript variant D (CG1640), mRNA 
0   11  NM_167368.1  CG1640-RE, transcript variant E (CG1640), mRNA 
0   NM_132651.2  CG1640-RA, transcript variant A (CG1640), mRNA 
0   NM_167365.1  CG1640-RB, transcript variant B (CG1640), mRNA 
0   NM_167369.1  CG1640-RF, transcript variant F (CG1640), mRNA 
0   NM_167597.1  CG32494-RA (CG32494), mRNA 
0   NM_132772.2  CG5599-RA (CG5599), mRNA 
0   NM_168869.1  CG4268-RC, transcript variant C (Pitslre), mRNA 
0   NM_140994.2  CG4268-RA, transcript variant A (Pitslre), mRNA 
0   NM_001043286.1  CG6383-RB, transcript variant B (crb), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
++ 
DC
 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.