National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5465R-1 
 Symbol MED16  Full Name Mediator complex subunit 16 
 CG No CG5465  Old CG No CG5465 
 Synonyms Trap95, Med16, CG5465, Sin4/TRAP95, dTRAP95, MED16 
 Accession No (Link to NCBI) NM_137806.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Terriente-Félix A, López-Varea A, de Celis JF.
Identification of genes affecting wing patterning through a loss-of-function mutagenesis screen and characterization of med15 function during wing development.
Genetics (2010) 185(2) 671-84 [ PubMed ID = 20233856 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGCTCAGTCTCCGCACGGAA 
 Primer Seq. 3'
aatctagaggtaccTGAGTAGCACGCATCCCTCGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTGCTCAGTC TCCGCACgGA ACATCGTTGC GTTTAGcGCC CTCCAGAGCG CCATATTTCC 
0061 GGCTTCCCAC GGAGGAGATG CCGGCGATGG ATCCTTGCCA GGAGCGGGTT TGGCCGTAGG 
0121 CGCGAGCAAC AGCCATGTGT ACGTGTGCGA CATCGTGACG CCGTGGGAAT ACTACAAGGT 
0181 GTGCTCTTCC AANATCGCTT ATCAGCGTCN CTCCAGTGGA GTCCCAATGG GGAGCAACTG 
0241 CTGCTTGGAT ACGTCGGCGG TCGCGTCGAG ATCTGGCAGC CGAGGAACCA GTCAATTAAC 
0301 CTATGGGTGC TGCAGTATTA CGCCACCGTG CCCAGCGAGG ACATTATAGA AGCACAGTTC 
0361 TTTCAGAATG GCAAAGGAGT GATCTTCAAT GCGCTGAAGA AGGATCACAC CTACTATGCG 
0421 GAGAAGTTCG AGCGGGTGGA GCAGCAGAGG CCCACTCTCA GCGGATTTGG CGGAGTGGCC 
0481 AGCGAGGGAT GCGTGCTACT CA 
 in silico PCR Fragment
0001 CTGCTCAGTC TCCGCACGGA ACATCGTTGC GTTTAGCGCC CTCCAGAGCG CCATATTTCC 
0061 GGCTTCCCAC GGAGGAGATG CCGGCGATGG ATCCTTGCCG GGAGCGGGTT TGGCCGTAGG 
0121 CGCGAGCAAC AGCCATGTGT ACGTGTGCGA CATCGTGACG CCGTGGGAAT ACTATAAGGT 
0181 GTGCTCCTCC AA-ATCGCTT ATCAGCGTC- CTCCAGTGGA GTCCCAATGG GGAGCAACTG 
0241 CTGCTTGGAT ACGTCGGCGG TCGCGTCGAG ATCTGGCAGC CGAGGAACCA GTCAATTAAC 
0301 CTATGGGTGC TGCAGTATTA CGCCACCGTG CCCAGCGAGG ACATTATAGA AGCACAGTTC 
0361 TTTCAGAATG GCAAAGGAGT GATCTTCAAT GCGCTGAAGA AGGATCACAC CTACTATGCG 
0421 GAGAAGTTCG AGCGGGTGGA GCAGCAGAGG CCCACTCTCA GCGGATTTGG CGGAGTGGCC 
0481 AGCGAGGGAT GCGTGCTACT CA 
 Assemble Data

5465R-1.IR_full       1   CTGCTCAGTCTCCGCACGGAACATCGTTGCGTTTAGCGCCCTCCAGAGCGCCATATTTCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5465R-1.in silico     1   CTGCTCAGTCTCCGCACGGAACATCGTTGCGTTTAGCGCCCTCCAGAGCGCCATATTTCC 60


5465R-1.IR_full       61  GGCTTCCCACGGAGGAGATGCCGGCGATGGATCCTTGCCAGGAGCGGGTTTGGCCGTAGG 120
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
5465R-1.in silico     61  GGCTTCCCACGGAGGAGATGCCGGCGATGGATCCTTGCCGGGAGCGGGTTTGGCCGTAGG 120


5465R-1.IR_full       121 CGCGAGCAACAGCCATGTGTACGTGTGCGACATCGTGACGCCGTGGGAATACTACAAGGT 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
5465R-1.in silico     121 CGCGAGCAACAGCCATGTGTACGTGTGCGACATCGTGACGCCGTGGGAATACTATAAGGT 180


5465R-1.IR_full       181 GTGCTCTTCCAANATCGCTTATCAGCGTCNCTCCAGTGGAGTCCCAATGGGGAGCAACTG 240
                          |||||| ||||| |||||||||||||||| ||||||||||||||||||||||||||||||
5465R-1.in silico     181 GTGCTCCTCCAA-ATCGCTTATCAGCGTC-CTCCAGTGGAGTCCCAATGGGGAGCAACTG 240


5465R-1.IR_full       241 CTGCTTGGATACGTCGGCGGTCGCGTCGAGATCTGGCAGCCGAGGAACCAGTCAATTAAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5465R-1.in silico     241 CTGCTTGGATACGTCGGCGGTCGCGTCGAGATCTGGCAGCCGAGGAACCAGTCAATTAAC 300


5465R-1.IR_full       301 CTATGGGTGCTGCAGTATTACGCCACCGTGCCCAGCGAGGACATTATAGAAGCACAGTTC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5465R-1.in silico     301 CTATGGGTGCTGCAGTATTACGCCACCGTGCCCAGCGAGGACATTATAGAAGCACAGTTC 360


5465R-1.IR_full       361 TTTCAGAATGGCAAAGGAGTGATCTTCAATGCGCTGAAGAAGGATCACACCTACTATGCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5465R-1.in silico     361 TTTCAGAATGGCAAAGGAGTGATCTTCAATGCGCTGAAGAAGGATCACACCTACTATGCG 420


5465R-1.IR_full       421 GAGAAGTTCGAGCGGGTGGAGCAGCAGAGGCCCACTCTCAGCGGATTTGGCGGAGTGGCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5465R-1.in silico     421 GAGAAGTTCGAGCGGGTGGAGCAGCAGAGGCCCACTCTCAGCGGATTTGGCGGAGTGGCC 480


5465R-1.IR_full       481 AGCGAGGGATGCGTGCTACTCA 502
                          ||||||||||||||||||||||
5465R-1.in silico     481 AGCGAGGGATGCGTGCTACTCA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137806.2  CG5465-RA (MED16), mRNA 
0   NM_078573.2  CG1822-RC, transcript variant C (bif), mRNA 
0   NM_167295.1  CG1822-RB, transcript variant B (bif), mRNA 
0   NM_141524.1  CG9626-RA (CG9626), mRNA 
0   NM_135440.1  CG4450-RA (CG4450), mRNA 
0   NM_132684.1  CG11158-RA (CG11158), mRNA 
0   NM_167530.1  CG9699-RA, transcript variant A (CG9699), mRNA 
0   NM_134804.3  CG7261-RA (CG7261), mRNA 
0   NM_168837.1  CG17233-RC, transcript variant C (CG17233), mRNA 
0   NM_140939.2  CG17233-RB, transcript variant B (CG17233), mRNA 
0   NM_167534.1  CG9699-RF, transcript variant F (CG9699), mRNA 
0   NM_167663.1  CG3917-RB, transcript variant B (Grip84), mRNA 
0   NM_078685.2  CG3917-RC, transcript variant C (Grip84), mRNA 
0   NM_167662.1  CG3917-RA, transcript variant A (Grip84), mRNA 
0   NM_079039.2  CG8380-RA (DAT), mRNA 
0   10  NM_079323.2  CG10601-RA, transcript variant A (mirr), mRNA 
0   NM_168505.1  CG10601-RB, transcript variant B (mirr), mRNA 
0   NM_057860.3  CG3582-RA (U2af38), mRNA 
0   NM_137276.2  CG6251-RA (Nup62), mRNA 
0   NM_131961.1  CG2861-RA, transcript variant A (CG2861), mRNA 
0   NM_167021.1  CG2861-RB, transcript variant B (CG2861), mRNA 
0   NM_080303.2  CG3707-RA, transcript variant A (wapl), mRNA 
0   NM_166931.1  CG3707-RB, transcript variant B (wapl), mRNA 
0   NM_142819.1  CG6954-RA (CG6954), mRNA 
0   NM_078516.2  CG12690-RA (CHES-1-like), mRNA 
0   NM_057737.2  CG15804-RA, transcript variant A (Dhc62B), mRNA 
0   NM_206236.1  CG15804-RB, transcript variant B (Dhc62B), mRNA 
0   NM_143782.2  CG3820-RA (Nup214), mRNA 
0   NM_206637.1  CG18155-RB, transcript variant B (CG18155), mRNA 
0   NM_132164.1  CG18155-RA, transcript variant A (CG18155), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.