National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5445R-4 
 Symbol CG5445  Full Name CG5445 
 CG No CG5445  Old CG No CG5445 
 Synonyms CG5445 
 Accession No (Link to NCBI) NM_132985.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Uechi H, Kuranaga E, Iriki T, Takano K, Hirayama S, Miura M, Hamazaki J, Murata S.
Ubiquitin-Binding Protein CG5445 Suppresses Aggregation and Cytotoxicity of Amyotrophic Lateral Sclerosis-linked TDP-43 in Drosophila.
Mol. Cell. Biol. (2017) [ PubMed ID = 29109084 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAACTACGAAAACGCCGCCGAG 
 Primer Seq. 3'
aatctagaggtaccCAGAAGTCCAGATAGCAGCCC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AACTACGAAA ACGCCGCCGA GATGCAGAAC ATGAACATGA ATCTGAATCT AAATCCGAAT 
0061 CCGAATCCAA ATTCGGACAG CCAGCAGCAG CAGCAACAAC AGATGCAATG TGAACCGTTA 
0121 TTCGGGCTCA CAACCAATAC AACAACAACC ACAAATCCCA TGATGGCCAT TCCCCTGCCC 
0181 GCGCCCCCAG GGCCGCAACT CCGCTCCGAA CAACAGTCCA AATTCGAATG CGAATCCCAA 
0241 CTCAAATCTG AGTCCCAGTC CATCCGCAAC AACCGCTAAC GCATCCGCAT CCACGATCAA 
0301 GTGTCTACCG ACGAACGACT TCGATATCGA CTCCCTGTTG CTGCAACAGT TCAGCTGTAT 
0361 GGGCACCACG GACCACGAAG ACCTCATCAG CCAGTTTCAG AGCCTAATGA ACAACCAGAT 
0421 GAACCGGGAA TCGGCCAGGT TTTACCTAGA GATGAGTAAC TGGAGCCTGC AGACGGCGGT 
0481 GGGCTGCTAT CTGGACTTCT G 
 in silico PCR Fragment
0001 AACTACGAAA ACGCCGCCGA GATGCAGAAC ATGAACATGA ATCTGAATCT AAATCCGAAT 
0061 CCGAATCCAA ATTCGGACAG CCAGCAGCAG CAGCAACAAC AGATGCAATG TGAACCGTTA 
0121 TTCGGGCTCA CAACCAATAC AACAACAACC ACAAATCCCA TGATGGCCAT TCCCCTGCCC 
0181 GCGCCCCCAG GGCCGC-ACT CCGCTCCGAA CAACAGTCCA AATTCGAATG CGAATCCCAA 
0241 CTCAAATCTG AGTCCCAGTC CATCCGCAAC AACCGCTAAC GCATCCGCAT CCACGATCAA 
0301 GTGTCTACCG ACGAACGACT TCGATATCGA CTCCCTGTTG CTGCAACAGT TCAGCTGTAT 
0361 GGGCACCACG GACCACGAAG ACCTCATCAG CCAGTTTCAG AGCCTAATGA ACAACCAGAT 
0421 GAACCGGGAA TCGGCCAGGT TTTACCTAGA GATGAGTAAC TGGAGCCTGC AGACGGCGGT 
0481 GGGCTGCTAT CTGGACTTCT G 
 Assemble Data

5445R-4.IR_full       1   AACTACGAAAACGCCGCCGAGATGCAGAACATGAACATGAATCTGAATCTAAATCCGAAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5445R-4.in silico     1   AACTACGAAAACGCCGCCGAGATGCAGAACATGAACATGAATCTGAATCTAAATCCGAAT 60


5445R-4.IR_full       61  CCGAATCCAAATTCGGACAGCCAGCAGCAGCAGCAACAACAGATGCAATGTGAACCGTTA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5445R-4.in silico     61  CCGAATCCAAATTCGGACAGCCAGCAGCAGCAGCAACAACAGATGCAATGTGAACCGTTA 120


5445R-4.IR_full       121 TTCGGGCTCACAACCAATACAACAACAACCACAAATCCCATGATGGCCATTCCCCTGCCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5445R-4.in silico     121 TTCGGGCTCACAACCAATACAACAACAACCACAAATCCCATGATGGCCATTCCCCTGCCC 180


5445R-4.IR_full       181 GCGCCCCCAGGGCCGCAACTCCGCTCCGAACAACAGTCCAAATTCGAATGCGAATCCCAA 240
                          |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
5445R-4.in silico     181 GCGCCCCCAGGGCCGC-ACTCCGCTCCGAACAACAGTCCAAATTCGAATGCGAATCCCAA 240


5445R-4.IR_full       241 CTCAAATCTGAGTCCCAGTCCATCCGCAACAACCGCTAACGCATCCGCATCCACGATCAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5445R-4.in silico     241 CTCAAATCTGAGTCCCAGTCCATCCGCAACAACCGCTAACGCATCCGCATCCACGATCAA 300


5445R-4.IR_full       301 GTGTCTACCGACGAACGACTTCGATATCGACTCCCTGTTGCTGCAACAGTTCAGCTGTAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5445R-4.in silico     301 GTGTCTACCGACGAACGACTTCGATATCGACTCCCTGTTGCTGCAACAGTTCAGCTGTAT 360


5445R-4.IR_full       361 GGGCACCACGGACCACGAAGACCTCATCAGCCAGTTTCAGAGCCTAATGAACAACCAGAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5445R-4.in silico     361 GGGCACCACGGACCACGAAGACCTCATCAGCCAGTTTCAGAGCCTAATGAACAACCAGAT 420


5445R-4.IR_full       421 GAACCGGGAATCGGCCAGGTTTTACCTAGAGATGAGTAACTGGAGCCTGCAGACGGCGGT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5445R-4.in silico     421 GAACCGGGAATCGGCCAGGTTTTACCTAGAGATGAGTAACTGGAGCCTGCAGACGGCGGT 480


5445R-4.IR_full       481 GGGCTGCTATCTGGACTTCTG 501
                          |||||||||||||||||||||
5445R-4.in silico     481 GGGCTGCTATCTGGACTTCTG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  54  NM_176748.1  CG5445-RD, transcript variant D (CG5445), mRNA 
100   482  54  NM_132985.3  CG5445-RA, transcript variant A (CG5445), mRNA 
100   482  54  NM_167568.2  CG5445-RC, transcript variant C (CG5445), mRNA 
100   482  54  NM_167567.1  CG5445-RB, transcript variant B (CG5445), mRNA 
3.11   15  88  321  671  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
3.11   15  88  321  671  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
3.11   15  88  321  671  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
2.9   14  23  60  139  NM_134474.4  CG32532-RA (CG32532), mRNA 
2.28   11  36  125  302  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
2.28   11  36  125  302  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
2.28   11  29  64  129  NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
2.28   11  29  64  129  NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
2.28   11  29  64  129  NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
2.28   11  16  51  113  NM_079939.2  CG5580-RA, transcript variant A (sbb), mRNA 
2.07   10  58  135  338  NM_168571.2  CG32133-RA (CG32133), mRNA 
2.07   10  25  58  164  NM_139799.3  CG10107-RA, transcript variant A (CG10107), mRNA 
2.07   10  25  58  164  NM_206286.1  CG10107-RC, transcript variant C (CG10107), mRNA 
2.07   10  18  50  110  NM_132126.1  CG3075-RA (CG3075), mRNA 
1.86   16  62  115  NM_132246.2  CG10555-RA (CG10555), mRNA 
1.65   25  68  148  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
1.65   25  68  148  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
1.65   24  37  97  NM_168413.1  CG32062-RB, transcript variant B (CG32062), mRNA 
1.65   24  37  97  NM_168412.1  CG32062-RD, transcript variant D (CG32062), mRNA 
1.65   23  60  123  NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
1.65   23  57  110  NM_176241.1  CG10543-RC, transcript variant C (CG10543), mRNA 
1.65   23  57  110  NM_166416.1  CG10543-RB, transcript variant B (CG10543), mRNA 
1.65   15  41  110  NM_140744.1  CG6064-RA (TORC), mRNA 
1.65   11  18  42  NM_169260.1  CG9755-RB, transcript variant B (pum), mRNA 
1.65   11  18  42  NM_176427.1  CG9755-RE, transcript variant E (pum), mRNA 
1.65   10  47  132  NM_132235.2  CG32717-RB, transcript variant B (sdt), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.