National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5436R-1 
 Symbol Hsp68  Full Name Heat shock protein 68 
 CG No CG5436  Old CG No CG5436 
 Synonyms hsp68, Hsp-68, HSP68, 68, CG5436, Hsp68 
 Accession No (Link to NCBI) NM_079750.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Lindström R, Lindholm P, Palgi M, Saarma M, Heino TI.
In vivo screening reveals interactions between Drosophila Manf and genes involved in the mitochondria and the ubiquinone synthesis pathway.
BMC Genet (2017) 18(1) 52 [ PubMed ID = 28578657 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGAATCGATTTGGGCACCACA 
 Primer Seq. 3'
aatctagaggtaccTTGATGATGCGGAGCACATTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GNAATCGATT TGGGCACCAC ATACTCCTGC GTGGGAGTCT TCCAGTACGG AAAAGTGGAG 
0061 ATCATTGCCA ACGACCAGGG TAACCGTACC ACACCATCGT ACGTGGCCTT CACCGACTCG 
0121 GAACGCCTTA TTGGAGATGC CGCCAAGAAC CAGGTGGCCA TGAACCCCAA GAACTCTGTG 
0181 TTCGATGCCA AACGCCTGAT TGGGCGTCGT TTCGANGNTT CCAAGATCCA GGAGGACATT 
0241 AAGCACTGGC CGTTCAAAGT GATCAACGAC AACGGCAAAC CAAAGATAAG CGTGGAGTTC 
0301 AAGGGCGCGA ATAAGTGCTT CTCTCCCGAG GAGATTAGCT CGATGGTACT CACCAAAATG 
0361 AAGGAGACTG CAGAAGCCTA CCTAGGCACT ACAGTGAAGG ACGCTGTCAT CACAGTGCCG 
0421 GCCTACTTTA ACGACTCCCA GCGCCAGGCA ACAAAGGATG CCGGTGCCAT CGCTGGCATC 
0481 AATGTGCTCC GCATCATCAA  
 in silico PCR Fragment
0001 GGAATCGATT TGGGCACCAC ATACTCCTGC GTGGGAGTCT TCCAGTACGG AAAAGTGGAG 
0061 ATCATTGCCA ACGACCAGGG TAACCGTACC ACACCATCGT ACGTGGCCTT CACCGACTCG 
0121 GAACGCCTTA TTGGAGATGC CGCCAAGAAC CAGGTGGCCA TGAACCCCAA GAACTCTGTG 
0181 TTCGATGCCA AACGCCTGAT TGGGCGTCGT TTCGACGATT CCAAGATCCA GGAGGACATT 
0241 AAGCACTGGC CGTTCAAAGT GATCAACGAC AACGGCAAAC CAAAGATAAG CGTGGAGTTC 
0301 AAGGGCGCGA ATAAGTGCTT CTCTCCCGAG GAGATTAGCT CGATGGTACT CACCAAAATG 
0361 AAGGAGACTG CAGAAGCCTA CCTGGGCACT ACAGTGAAGG ACGCTGTCAT CACAGTGCCG 
0421 GCCTACTTCA ACGACTCCCA GCGCCAGGCA ACAAAGGATG CTGGTGCCAT CGCTGGCATC 
0481 AATGTGCTCC GCATCATCAA  
 Assemble Data

5436R-1.IR_full       1   GNAATCGATTTGGGCACCACATACTCCTGCGTGGGAGTCTTCCAGTACGGAAAAGTGGAG 60
                          | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5436R-1.in silico     1   GGAATCGATTTGGGCACCACATACTCCTGCGTGGGAGTCTTCCAGTACGGAAAAGTGGAG 60


5436R-1.IR_full       61  ATCATTGCCAACGACCAGGGTAACCGTACCACACCATCGTACGTGGCCTTCACCGACTCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5436R-1.in silico     61  ATCATTGCCAACGACCAGGGTAACCGTACCACACCATCGTACGTGGCCTTCACCGACTCG 120


5436R-1.IR_full       121 GAACGCCTTATTGGAGATGCCGCCAAGAACCAGGTGGCCATGAACCCCAAGAACTCTGTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5436R-1.in silico     121 GAACGCCTTATTGGAGATGCCGCCAAGAACCAGGTGGCCATGAACCCCAAGAACTCTGTG 180


5436R-1.IR_full       181 TTCGATGCCAAACGCCTGATTGGGCGTCGTTTCGANGNTTCCAAGATCCAGGAGGACATT 240
                          ||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||
5436R-1.in silico     181 TTCGATGCCAAACGCCTGATTGGGCGTCGTTTCGACGATTCCAAGATCCAGGAGGACATT 240


5436R-1.IR_full       241 AAGCACTGGCCGTTCAAAGTGATCAACGACAACGGCAAACCAAAGATAAGCGTGGAGTTC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5436R-1.in silico     241 AAGCACTGGCCGTTCAAAGTGATCAACGACAACGGCAAACCAAAGATAAGCGTGGAGTTC 300


5436R-1.IR_full       301 AAGGGCGCGAATAAGTGCTTCTCTCCCGAGGAGATTAGCTCGATGGTACTCACCAAAATG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5436R-1.in silico     301 AAGGGCGCGAATAAGTGCTTCTCTCCCGAGGAGATTAGCTCGATGGTACTCACCAAAATG 360


5436R-1.IR_full       361 AAGGAGACTGCAGAAGCCTACCTAGGCACTACAGTGAAGGACGCTGTCATCACAGTGCCG 420
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
5436R-1.in silico     361 AAGGAGACTGCAGAAGCCTACCTGGGCACTACAGTGAAGGACGCTGTCATCACAGTGCCG 420


5436R-1.IR_full       421 GCCTACTTTAACGACTCCCAGCGCCAGGCAACAAAGGATGCCGGTGCCATCGCTGGCATC 480
                          |||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||
5436R-1.in silico     421 GCCTACTTCAACGACTCCCAGCGCCAGGCAACAAAGGATGCTGGTGCCATCGCTGGCATC 480


5436R-1.IR_full       481 AATGTGCTCCGCATCATCAA 500
                          ||||||||||||||||||||
5436R-1.in silico     481 AATGTGCTCCGCATCATCAA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079750.3  CG5436-RA (Hsp68), mRNA 
4.14   20  36  91  65  NM_169441.1  CG31366-RA (Hsp70Aa), mRNA 
4.14   20  36  91  65  NM_080059.2  CG18743-RA (Hsp70Ab), mRNA 
2.69   13  45  48  79  NM_176503.1  CG4264-RF, transcript variant F (Hsc70-4), mRNA 
2.69   13  45  48  79  NM_169625.1  CG4264-RB, transcript variant B (Hsc70-4), mRNA 
2.69   13  45  48  79  NM_169627.1  CG4264-RD, transcript variant D (Hsc70-4), mRNA 
2.69   13  45  48  79  NM_169626.1  CG4264-RC, transcript variant C (Hsc70-4), mRNA 
2.69   13  45  48  79  NM_176502.1  CG4264-RE, transcript variant E (Hsc70-4), mRNA 
2.69   13  45  48  79  NM_079632.4  CG4264-RA, transcript variant A (Hsc70-4), mRNA 
2.69   13  29  38  71  NM_079339.2  CG8937-RA, transcript variant A (Hsc70-1), mRNA 
2.69   13  29  38  69  NM_168568.2  CG8937-RC, transcript variant C (Hsc70-1), mRNA 
2.48   12  31  78  94  NM_176486.1  CG5834-RA (Hsp70Bbb), mRNA 
2.48   12  31  78  94  NM_169469.1  CG31449-RA (Hsp70Ba), mRNA 
2.48   12  31  78  94  NM_141952.1  CG6489-RA (Hsp70Bc), mRNA 
2.48   12  31  78  94  NM_080188.2  CG31359-RA (Hsp70Bb), mRNA 
1.86   11  51  105  NM_079615.2  CG7756-RA (Hsc70-2), mRNA 
1.65   22  50  NM_168569.1  CG8937-RD, transcript variant D (Hsc70-1), mRNA 
0.41   15  14  22  NM_079017.2  CG8542-RA (Hsc70-5), mRNA 
0.41   11  46  63  NM_167307.1  CG4147-RC, transcript variant C (Hsc70-3), mRNA 
0.41   11  46  63  NM_167306.1  CG4147-RA, transcript variant A (Hsc70-3), mRNA 
0.41   11  46  63  NM_167308.1  CG4147-RD, transcript variant D (Hsc70-3), mRNA 
0.41   11  46  63  NM_078577.2  CG4147-RB, transcript variant B (Hsc70-3), mRNA 
0.41   NM_080075.2  CG32400-RA (Lcp65Ab1), mRNA 
0.41   NM_176291.1  CG18773-RA (Lcp65Ab2), mRNA 
0   NM_167193.1  CG32702-RA (CG32702), mRNA 
0   NM_141846.2  CG6830-RA (CG6830), mRNA 
0   NM_138069.2  CG4563-RA (CG4563), mRNA 
0   NM_079214.2  CG5495-RA (Txl), mRNA 
0   NM_136439.2  CG11127-RA (CG11127), mRNA 
0   NM_079512.2  CG2899-RA (ksr), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
DC
++ 
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
++ 
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.