National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5406R-2 
 Symbol sif  Full Name still life 
 CG No CG34418  Old CG No CG5406 
 Synonyms FBgn0085447, sif, CG5406, CG5256, still life, slf, unnamed, still life type 2, SIF, RhoGEF, Still life, still life type 1, CG32414, CG34418 
 Accession No (Link to NCBI) NM_079908.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Wang H, Qiu Z, Xu Z, Chen SJ, Luo J, Wang X, Chen J.
aPKC is a key polarity determinant in coordinating the function of three distinct cell polarities during collective migration.
Development (2018) 145(9) [ PubMed ID = 29636381 ] [ RRC reference ]

Minami R, Sato C, Yamahama Y, Kubo H, Hariyama T, Kimura KI.
An RNAi Screen for Genes Involved in Nanoscale Protrusion Formation on Corneal Lens in Drosophila melanogaster.
Zoolog Sci (2016) 33(6) 583-591 [ PubMed ID = 27927092 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGGACGATGATCGAATGAGC 
 Primer Seq. 3'
aatctagaggtaccTCCAGTTTTTCCGCGATGCCT 
 Predicted Fragment Size
501 
 IR fragment full Seq
0001 TCGGACGATG ATCGAATGAG CCTAACTACC GCCGTTTCGN ATGAAGATGA TGGGGAAAGT 
0061 GTCATGGCGT CACCATATAA AGCAAAGGCA ACTGGCACCG CNTGCATCCT CCTTCAATTG 
0121 CACGGGAGCT GTTCGCAAAN NCGGCTTCCT ATCGGTAAAG AAATGGTTAC TACGCAAGAA 
0181 GCACCAGATC GAGCTGGCAA GAAAGCGGGG CTGGAAGGGC TACTGGGTGT GCCTGAAGGG 
0241 CACCACGCTG CTCTTCTATC CGTGCGATTC CCGGGAGGGC CGGAGTGTGG ANGCGGCGCC 
0301 CAAGCACTTG ATTATCGTGG ATGGTGCAAT TATGCAANCG ATACCGGAGC ATCCCAAGCG 
0361 CGACTACATC TTCTGTCTGA GTACGGCGTN NGGCGATGCC TATCTCTTCC AGGCGCCCTG 
0421 TCAGGTTGAG CTGGAGAACT GGGTGAATAG CATACACAgN GCCTGTGcCG CCgNCTTTGC 
0481 CAGGCATCGC GGAAAAACTG GA 
 in silico PCR Fragment
0001 TCGGACGATG ATCGAATGAG CCTAACTACC GCCGTTTCGG ATGAAGATGA TGGGGAAAGT 
0061 GTCATGGCGT CACCATATAA AGCAAAGGCA ACTGGCACCG C-TGCATCCT CCTTCAATTG 
0121 CACGGGAGCT GTTCGCAAAG CCGGCTTCCT ATCGGTAAAG AAATGGTTAC TACGCAAGAA 
0181 GCACCAGATC GAGCTGGCAA GAAAGCGGGG CTGGAAGGGC TACTGGGTGT GCCTGAAGGG 
0241 CACCACGCTG CTCTTCTATC CGTGCGATTC CCGGGAGGGC CGGAGTGTGG AGGCGGCGCC 
0301 CAAGCACTTG ATTATCGTGG ATGGTGCAAT TATGCAACCG ATACCGGAGC ATCCCAAGCG 
0361 CGACTACATC TTCTGTCTGA GTACGGCGTT CGGCGATGCC TATCTCTTCC AGGCGCCCTG 
0421 TCAGGTTGAG CTGGAGAACT GGGTGAATAG CATACACAGC GCCTGTGCCG CCGCCTTTGC 
0481 CAGGCATCGC GGAAAAACTG GA 
 Assemble Data

5406R-2.IR_full       1   TCGGACGATGATCGAATGAGCCTAACTACCGCCGTTTCGNATGAAGATGATGGGGAAAGT 60
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
5406R-2.in silico     1   TCGGACGATGATCGAATGAGCCTAACTACCGCCGTTTCGGATGAAGATGATGGGGAAAGT 60


5406R-2.IR_full       61  GTCATGGCGTCACCATATAAAGCAAAGGCAACTGGCACCGCNTGCATCCTCCTTCAATTG 120
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
5406R-2.in silico     61  GTCATGGCGTCACCATATAAAGCAAAGGCAACTGGCACCGC-TGCATCCTCCTTCAATTG 120


5406R-2.IR_full       121 CACGGGAGCTGTTCGCAAANNCGGCTTCCTATCGGTAAAGAAATGGTTACTACGCAAGAA 180
                          |||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||
5406R-2.in silico     121 CACGGGAGCTGTTCGCAAAGCCGGCTTCCTATCGGTAAAGAAATGGTTACTACGCAAGAA 180


5406R-2.IR_full       181 GCACCAGATCGAGCTGGCAAGAAAGCGGGGCTGGAAGGGCTACTGGGTGTGCCTGAAGGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5406R-2.in silico     181 GCACCAGATCGAGCTGGCAAGAAAGCGGGGCTGGAAGGGCTACTGGGTGTGCCTGAAGGG 240


5406R-2.IR_full       241 CACCACGCTGCTCTTCTATCCGTGCGATTCCCGGGAGGGCCGGAGTGTGGANGCGGCGCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
5406R-2.in silico     241 CACCACGCTGCTCTTCTATCCGTGCGATTCCCGGGAGGGCCGGAGTGTGGAGGCGGCGCC 300


5406R-2.IR_full       301 CAAGCACTTGATTATCGTGGATGGTGCAATTATGCAANCGATACCGGAGCATCCCAAGCG 360
                          ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
5406R-2.in silico     301 CAAGCACTTGATTATCGTGGATGGTGCAATTATGCAACCGATACCGGAGCATCCCAAGCG 360


5406R-2.IR_full       361 CGACTACATCTTCTGTCTGAGTACGGCGTNNGGCGATGCCTATCTCTTCCAGGCGCCCTG 420
                          |||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||
5406R-2.in silico     361 CGACTACATCTTCTGTCTGAGTACGGCGTTCGGCGATGCCTATCTCTTCCAGGCGCCCTG 420


5406R-2.IR_full       421 TCAGGTTGAGCTGGAGAACTGGGTGAATAGCATACACAGNGCCTGTGCCGCCGNCTTTGC 480
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||
5406R-2.in silico     421 TCAGGTTGAGCTGGAGAACTGGGTGAATAGCATACACAGCGCCTGTGCCGCCGCCTTTGC 480


5406R-2.IR_full       481 CAGGCATCGCGGAAAAACTGGA 502
                          ||||||||||||||||||||||
5406R-2.in silico     481 CAGGCATCGCGGAAAAACTGGA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   483  NM_168126.1  CG5406-RB, transcript variant B (sif), mRNA 
100   483  NM_206278.1  CG5406-RC, transcript variant C (sif), mRNA 
100   483  NM_079908.2  CG5406-RA, transcript variant A (sif), mRNA 
0.2   NM_206236.1  CG15804-RB, transcript variant B (Dhc62B), mRNA 
0.2   NM_057737.2  CG15804-RA, transcript variant A (Dhc62B), mRNA 
0   NM_136858.1  CG13192-RA (CG13192), mRNA 
0   NM_142188.2  CG6276-RA (CG6276), mRNA 
0   NM_130513.2  CG3711-RA, transcript variant A (CG3711), mRNA 
0   NM_001038730.1  CG3711-RB, transcript variant B (CG3711), mRNA 
0   NM_133141.1  CG7992-RA (CG7992), mRNA 
0   NM_001038869.1  CG33958-RA (CG33958), mRNA 
0   NM_080370.3  CG8024-RB, transcript variant B (ltd), mRNA 
0   NM_136542.1  CG30361-RA, transcript variant A (mXr), mRNA 
0   NM_142067.2  CG9925-RA (CG9925), mRNA 
0   NM_176184.2  CG18250-RC, transcript variant C (Dg), mRNA 
0   NM_167758.1  CG14476-RC, transcript variant C (CG14476), mRNA 
0   NM_143888.4  CG14476-RB, transcript variant B (CG14476), mRNA 
0   NM_167757.1  CG14476-RA, transcript variant A (CG14476), mRNA 
0   NM_167759.1  CG14476-RD, transcript variant D (CG14476), mRNA 
0   NM_167760.1  CG14476-RE, transcript variant E (CG14476), mRNA 
0   NM_079034.2  CG8425-RA (Jhe), mRNA 
0   NM_136570.2  CG8266-RA, transcript variant A (sec31), mRNA 
0   NM_165630.1  CG8266-RB, transcript variant B (sec31), mRNA 
0   NM_135034.1  CG15624-RA, transcript variant A (hoe2), mRNA 
0   NM_001014466.1  CG15624-RB, transcript variant B (hoe2), mRNA 
0   NM_137843.2  CG4329-RA, transcript variant A (CG4329), mRNA 
0   NM_166537.1  CG4329-RB, transcript variant B (CG4329), mRNA 
0   NM_132314.1  CG15369-RA (CG15369), mRNA 
0   NM_132643.2  CG1764-RA (CG1764), mRNA 
0   NM_170534.1  CG1462-RB, transcript variant B (Aph-4), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.