National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5397R-1 
 Symbol CG5397  Full Name CG5397 
 CG No CG5397  Old CG No CG5397 
 Synonyms CT16527, CG5397 
 Accession No (Link to NCBI) NM_134747.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]

Yano H, Yamamoto-Hino M, Awano W, Aoki-Kinoshita KF, Tsuda-Sakurai K, Okano H, Goto S.
Identification of proteasome components required for apical localization of Chaoptin using functional genomics.
J. Neurogenet. (2012) 26(1) 53-63 [ PubMed ID = 22417167 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GTGGTGATCTTGGCCAGCTGCAAGTCTGGCGGGGATGCGCACGTTCGCGTGAAGCGGATA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTGGGTGGCAAGCAGTCGAAGGCGCCGCCCGTCGATGATCCCGTGATCTTCGCGAGACTC 120

                          |||||||||||||||||||||| |||||||||| ||||||||||||||||| ||||| || silico     121 TTTGATCGCGATGCGCGAGTGG-AGGGATTCCGGAATCCCAGCACGGGCATCTACTCCTT 180

                          ||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| silico     181 TCTGGGAATGCACTACGCGGAGCCACCTGTTGGTCCACTGAGATACTCCAGACCGGTGTA 240

                          ||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| silico     241 CAAAAGGCTGGCTGGTGACTTCAATGCCACCAAACAT-GGCCCACCTTGTATACAGCCGC 300

                          ||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| silico     301 ATCCGCAGTTTCCTCAGAGGATTATCGGCGATGAGGATTGCCTGCTGCTGAACGTCTACA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CCCCGCAAATGCCGGATGAGACCACAGGGCTGCCAGTGTTCGTTTGGATTCACCCGGGTG 420

                          ||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| silico     421 GCTATCGATATGGATCGGCGGCCCAGTACGATGCCACGCCTATGGCCCAAAGGGGCGCAA 480

5397R-1.IR_full       481 TCGTGGTGGCTCCTCAGTATCG 502
                          |||||||||||||||||||||| silico     481 TCGTGGTGGCTCCTCAGTATCG 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134747.2  CG5397-RA (CG5397), mRNA 
0   NM_169775.1  CG7467-RA, transcript variant A (osa), mRNA 
0   NM_079668.2  CG7467-RB, transcript variant B (osa), mRNA 
0   NM_206506.1  CG7467-RC, transcript variant C (osa), mRNA 
0   NM_132058.2  CG5966-RA (CG5966), mRNA 
0   NM_079034.2  CG8425-RA (Jhe), mRNA 
0   NM_078723.2  CG3022-RA, transcript variant A (GABA-B-R3), mRNA 
0   NM_164387.1  CG3022-RB, transcript variant B (GABA-B-R3), mRNA 
0   NM_134793.2  CG7291-RA (NPC2), mRNA 
0   NM_132650.1  CG10617-RA (CG10617), mRNA 
0   NM_139743.2  CG10483-RA (CG10483), mRNA 
0   NM_135753.2  CG9934-RA (CG9934), mRNA 
0   NM_139764.2  CG13295-RA (CG13295), mRNA 
0   NM_139623.2  CG1309-RA (CG1309), mRNA 
0   NM_206438.1  CG17603-RB, transcript variant B (Taf1), mRNA 
0   NM_206437.1  CG17603-RC, transcript variant C (Taf1), mRNA 
0   NM_057608.4  CG17603-RA, transcript variant A (Taf1), mRNA 
0   NM_134613.2  CG1644-RA (Cyp6t1), mRNA 
0   NM_166881.1  CG32813-RE, transcript variant E (CG32813), mRNA 
0   NM_001042903.1  CG7527-RB, transcript variant B (CadN2), mRNA 
0   NM_136011.2  CG7527-RA, transcript variant A (CadN2), mRNA 
0   NM_133070.1  CG15046-RA (CG15046), mRNA 
0   NM_136347.1  CG14471-RB, transcript variant B (CG14471), mRNA 
0   NM_132430.2  CG11207-RA (feo), mRNA 
0   NM_167875.1  CG9181-RD, transcript variant D (Ptp61F), mRNA 
0   NM_057339.3  CG9181-RA, transcript variant A (Ptp61F), mRNA 
0   NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0   NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   NM_136702.2  CG18445-RA (CG18445), mRNA 
0   NM_078676.3  CG6223-RA (betaCop), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.