National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5390R-1 
 Symbol CG5390  Full Name CG5390 
 CG No CG5390  Old CG No CG5390 
 Synonyms c-SPH35, SPH35, gh06341, BEST:GH06341, CG5390 
 Accession No (Link to NCBI) NM_135530.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCTGTGCATATTTTCCTGTG 
 Primer Seq. 3'
aatctagaggtaccGTACAGGTTAAGGTTGCCTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCCTGTGCAT ATTTTCCTGT GGTGCCCAGG ACTCTTCCTT GGACAAATTG ATATCGGACA 
0061 TCTTTAAAAC GGACGAAACA CCCAAACCAT CATCCCCTCC CCCGCCAGTG GTGAACCCCA 
0121 AGGATTCGTC CGGTAGCACG GGNATCCCAA AACGGAGGAT CCAGTTCAAC GCAGTACCAG 
0181 TCCTGTGGCG ATCAAAAGGA GTGTGTTCCT CGCTGGTTGT GCGCCAATGA TACGATTAAC 
0241 ACCAGTGGCG ATGGTATCAT TGACATTCGA CTTGGTACGG ACGCCGAATG CAAGAACTAT 
0301 TTGGATCTTT GCTGTGATCT GCCCAACAAG AGAAAAGATC CGATTTTCGA GTTTAAGCCT 
0361 GATCATCCCG AGGGCTGCGG TTACCAAAAT NCCAACGGCG TTGGCTTTAA GATCACTGGA 
0421 GCTGTCAACC AGGAgGCCGA ATTCGGCGAA TTCCCCTGGA TGCTGGCCAT TCTCCGGGAA 
0481 GAAGGCAACC TTAAcCTGTA C 
 in silico PCR Fragment
0001 GCCTGTGCAT ATTTTCCTGT GGTGCCCAGG ACTCTTCCTT GGACAAATTG ATATCGGACA 
0061 TCTTTAAAAC GGACGAAACA CCCAAACCAT CATCCCCTCC CCCGCCAGTG GTGAACCCCA 
0121 AGGATTCGTC CGGTAGCACG GG-ATCCGAA AACGGAGGAT CGAGTTCAAC GCAGTACCAG 
0181 TCCTGTGGCG ATCAAAAGGA GTGTGTTCCT CGCTGGTTGT GCGCCAATGA TACGATTAAC 
0241 ACCAGTGGCG ATGGTATCAT TGACATTCGA CTTGGTACGG ACGCCGAATG CAAGAACTAT 
0301 TTGGATCTTT GCTGTGATCT GCCCAACAAG AGAAAAGATC CGATTTTCGA GTTTAAGCCT 
0361 GATCATCCCG AGGGCTGCGG TTACCAAAAT CCCAACGGCG TTGGCTTTAA GATCACTGGA 
0421 GCTGTCAACC AGGAGGCCGA ATTCGGCGAA TTCCCCTGGA TGCTGGCCAT TCTCCGGGAA 
0481 GAAGGCAACC TTAACCTGTA C 
 Assemble Data

5390R-1.IR_full       1   GCCTGTGCATATTTTCCTGTGGTGCCCAGGACTCTTCCTTGGACAAATTGATATCGGACA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5390R-1.in silico     1   GCCTGTGCATATTTTCCTGTGGTGCCCAGGACTCTTCCTTGGACAAATTGATATCGGACA 60


5390R-1.IR_full       61  TCTTTAAAACGGACGAAACACCCAAACCATCATCCCCTCCCCCGCCAGTGGTGAACCCCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5390R-1.in silico     61  TCTTTAAAACGGACGAAACACCCAAACCATCATCCCCTCCCCCGCCAGTGGTGAACCCCA 120


5390R-1.IR_full       121 AGGATTCGTCCGGTAGCACGGGNATCCCAAAACGGAGGATCCAGTTCAACGCAGTACCAG 180
                          |||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||||
5390R-1.in silico     121 AGGATTCGTCCGGTAGCACGGG-ATCCGAAAACGGAGGATCGAGTTCAACGCAGTACCAG 180


5390R-1.IR_full       181 TCCTGTGGCGATCAAAAGGAGTGTGTTCCTCGCTGGTTGTGCGCCAATGATACGATTAAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5390R-1.in silico     181 TCCTGTGGCGATCAAAAGGAGTGTGTTCCTCGCTGGTTGTGCGCCAATGATACGATTAAC 240


5390R-1.IR_full       241 ACCAGTGGCGATGGTATCATTGACATTCGACTTGGTACGGACGCCGAATGCAAGAACTAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5390R-1.in silico     241 ACCAGTGGCGATGGTATCATTGACATTCGACTTGGTACGGACGCCGAATGCAAGAACTAT 300


5390R-1.IR_full       301 TTGGATCTTTGCTGTGATCTGCCCAACAAGAGAAAAGATCCGATTTTCGAGTTTAAGCCT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5390R-1.in silico     301 TTGGATCTTTGCTGTGATCTGCCCAACAAGAGAAAAGATCCGATTTTCGAGTTTAAGCCT 360


5390R-1.IR_full       361 GATCATCCCGAGGGCTGCGGTTACCAAAATNCCAACGGCGTTGGCTTTAAGATCACTGGA 420
                          |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
5390R-1.in silico     361 GATCATCCCGAGGGCTGCGGTTACCAAAATCCCAACGGCGTTGGCTTTAAGATCACTGGA 420


5390R-1.IR_full       421 GCTGTCAACCAGGAGGCCGAATTCGGCGAATTCCCCTGGATGCTGGCCATTCTCCGGGAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5390R-1.in silico     421 GCTGTCAACCAGGAGGCCGAATTCGGCGAATTCCCCTGGATGCTGGCCATTCTCCGGGAA 480


5390R-1.IR_full       481 GAAGGCAACCTTAACCTGTAC 501
                          |||||||||||||||||||||
5390R-1.in silico     481 GAAGGCAACCTTAACCTGTAC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135530.2  CG5390-RA (CG5390), mRNA 
0.82   NM_136099.2  CG17344-RA (CG17344), mRNA 
0   NM_057675.3  CG8169-RA (Pms2), mRNA 
0   NM_166077.1  CG12424-RC, transcript variant C (CG12424), mRNA 
0   NM_137165.1  CG12424-RA, transcript variant A (CG12424), mRNA 
0   NM_166076.1  CG12424-RB, transcript variant B (CG12424), mRNA 
0   NM_136033.2  CG12750-RA (ncm), mRNA 
0   11  NM_165220.1  CG6605-RA (BicD), mRNA 
0   NM_142884.1  CG4408-RA (CG4408), mRNA 
0   NM_001043088.1  CG10956-RB (CG10956), mRNA 
0   NM_169653.2  CG31302-RB, transcript variant B (CG31302), mRNA 
0   NM_169652.2  CG31302-RA, transcript variant A (CG31302), mRNA 
0   NM_169654.2  CG31302-RC, transcript variant C (CG31302), mRNA 
0   NM_136559.2  CG8738-RA (CG8738), mRNA 
0   NM_057420.3  CG7875-RA (trp), mRNA 
0   NM_140175.2  CG6297-RB, transcript variant B (JIL-1), mRNA 
0   NM_168439.1  CG6297-RA, transcript variant A (JIL-1), mRNA 
0   NM_135753.2  CG9934-RA (CG9934), mRNA 
0   NM_142786.1  CG13847-RA (CG13847), mRNA 
0   NM_057552.2  CG1454-RA (wdn), mRNA 
0   NM_057615.3  CG15442-RA (RpL27A), mRNA 
0   NM_078920.1  CG12837-RA (Tsp42Er), mRNA 
0   10  NM_164725.1  CG9188-RE, transcript variant E (sip2), mRNA 
0   10  NM_164724.1  CG9188-RD, transcript variant D (sip2), mRNA 
0   10  NM_164723.1  CG9188-RC, transcript variant C (sip2), mRNA 
0   10  NM_135246.2  CG9188-RA, transcript variant A (sip2), mRNA 
0   10  NM_164722.1  CG9188-RB, transcript variant B (sip2), mRNA 
0   NM_206720.1  CG8948-RD, transcript variant D (Graf), mRNA 
0   NM_206718.1  CG8948-RF, transcript variant F (Graf), mRNA 
0   NM_206722.1  CG8948-RB, transcript variant B (Graf), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.