National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5370R-2 
 Symbol Dcp-1  Full Name Death caspase-1 
 CG No CG5370  Old CG No CG5370 
 Synonyms Dcp-1, dcp-1, DCP-1, Dcp1, dcp1, DCP1, l(2)02132, l(2)01862, CG5370 
 Accession No (Link to NCBI) NM_057626.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Li M, Sun S, Priest J, Bi X, Fan Y.
Characterization of TNF-induced cell death in Drosophila reveals caspase- and JNK-dependent necrosis and its role in tumor suppression.
Cell Death Dis (2019) 10(8) 613 [ PubMed ID = 31409797 ] [ RRC reference ]

Zhang S, Chen C, Wu C, Yang Y, Li W, Xue L.
The canonical Wg signaling modulates Bsk-mediated cell death in Drosophila.
Cell Death Dis (2015) 6 e1713 [ PubMed ID = 25855961 ] [ RRC reference ]

Leulier F, Ribeiro PS, Palmer E, Tenev T, Takahashi K, Robertson D, Zachariou A, Pichaud F, Ueda R, Meier P.
Systematic in vivo RNAi analysis of putative components of the Drosophila cell death machinery.
Cell Death Differ. (2006) 13(10) 1663-74 [ PubMed ID = 16485033 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACGAGTGCGTAACCAGAAAC 
 Primer Seq. 3'
aatctagaggtaccAGCTTGTACTGCGTATCCTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GACGAGTGCG TAACCAGAAA CTACGGAGtN NGCATTCGCA GCCCAAATGG ATCGGAAAAT 
0061 CGGGGCAGCT TTATAATGGC TGATAATACC GATGCCAAgG GNTGTACGCC GGAGTCTCTT 
0121 GTTGTTGGTG GTGCAACTGC AGCGAGCCCC TTGCCNGNCA ACAAGTTTGT GNCTCNAATG 
0181 NCCGTgGAAN GATATGCAAG CGAATACAAC ATGAGTCACA ANGCACCGCG GAGTTGCGCT 
0241 GATNCTTCAA CCACGAATTC TTCGACATAC CCTCGCTGAA GAGCCGCACC GGAACAAATG 
0301 TCGATGCCCA AGAGCTGAAA AAGGCCTTTG AAAACCTGGG ATTCGCGGTG TCCGTGCACA 
0361 AGGACTGCAA GTTGAGGGAC ATCCTGAAGC ACGTGGGGAA GGCCGCCGAG TTGGACCACA 
0421 CGGACAACGA CTGcCTTGCG GTGGCCATAC TCTCGCACGG GGAGCACGGC TACCTGTACG 
0481 CCAAGGATAC GCAGTACAAG CT 
 in silico PCR Fragment
0001 GACGAGTGCG TAACCAGAAA CTACGGAGTA GGCATTCGCA GCCCAAATGG ATCGGAAAAT 
0061 CGGGGCAGCT TTATAATGGC TGATAATACC GATGCCAAGG GCTGTACGCC GGAGTCTCTT 
0121 GTTGTTGGTG GTGCAACTGC AGCGAGCCCC TTGCCGGCCA ACAAGTTTGT GGCTCGAATG 
0181 CCCGTGGAAC GATATGCAAG CGAATACAAC ATGAGTCACA A-GCACCGCG GAGTTGCGCT 
0241 GAT-CTTCAA CCACGAATTC TTCGACATAC CCTCGCTGAA GAGCCGCACC GGAACAAATG 
0301 TCGATGCCCA AGAGCTGAAA AAGGCCTTTG AAAACCTGGG ATTCGCGGTG TCCGTGCACA 
0361 AGGACTGCAA GTTGAGGGAC ATCCTGAAGC ACGTGGGGAA GGCCGCCGAG TTGGACCACA 
0421 CGGACAACGA CTGCCTTGCG GTGGCCATAC TCTCGCACGG GGAGCACGGC TACCTGTACG 
0481 CCAAGGATAC GCAGTACAAG CT 
 Assemble Data

5370R-2.IR_full       1   GACGAGTGCGTAACCAGAAACTACGGAGTNNGCATTCGCAGCCCAAATGGATCGGAAAAT 60
                          |||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||
5370R-2.in silico     1   GACGAGTGCGTAACCAGAAACTACGGAGTAGGCATTCGCAGCCCAAATGGATCGGAAAAT 60


5370R-2.IR_full       61  CGGGGCAGCTTTATAATGGCTGATAATACCGATGCCAAGGGNTGTACGCCGGAGTCTCTT 120
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
5370R-2.in silico     61  CGGGGCAGCTTTATAATGGCTGATAATACCGATGCCAAGGGCTGTACGCCGGAGTCTCTT 120


5370R-2.IR_full       121 GTTGTTGGTGGTGCAACTGCAGCGAGCCCCTTGCCNGNCAACAAGTTTGTGNCTCNAATG 180
                          ||||||||||||||||||||||||||||||||||| | ||||||||||||| ||| ||||
5370R-2.in silico     121 GTTGTTGGTGGTGCAACTGCAGCGAGCCCCTTGCCGGCCAACAAGTTTGTGGCTCGAATG 180


5370R-2.IR_full        181 CCGTGGAANGATATGCAAGCGAATACAACATGAGTCACAANGCACCGCGGAGTTGCGCT 239
                           |||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||
5370R-2.in silico      181 CCGTGGAACGATATGCAAGCGAATACAACATGAGTCACAA-GCACCGCGGAGTTGCGCT 239


5370R-2.IR_full       241 GATNCTTCAACCACGAATTCTTCGACATACCCTCGCTGAAGAGCCGCACCGGAACAAATG 299
                          ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5370R-2.in silico     241 GAT-CTTCAACCACGAATTCTTCGACATACCCTCGCTGAAGAGCCGCACCGGAACAAATG 299


5370R-2.IR_full       301 TCGATGCCCAAGAGCTGAAAAAGGCCTTTGAAAACCTGGGATTCGCGGTGTCCGTGCACA 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5370R-2.in silico     301 TCGATGCCCAAGAGCTGAAAAAGGCCTTTGAAAACCTGGGATTCGCGGTGTCCGTGCACA 359


5370R-2.IR_full       361 AGGACTGCAAGTTGAGGGACATCCTGAAGCACGTGGGGAAGGCCGCCGAGTTGGACCACA 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5370R-2.in silico     361 AGGACTGCAAGTTGAGGGACATCCTGAAGCACGTGGGGAAGGCCGCCGAGTTGGACCACA 419


5370R-2.IR_full       421 CGGACAACGACTGCCTTGCGGTGGCCATACTCTCGCACGGGGAGCACGGCTACCTGTACG 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5370R-2.in silico     421 CGGACAACGACTGCCTTGCGGTGGCCATACTCTCGCACGGGGAGCACGGCTACCTGTACG 479


5370R-2.IR_full       481 CCAAGGATACGCAGTACAAGCT 501
                          ||||||||||||||||||||||
5370R-2.in silico     481 CCAAGGATACGCAGTACAAGCT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057626.3  CG5370-RA (Dcp-1), mRNA 
0.2   NM_137155.2  CG10228-RA (Pcf11), mRNA 
0   NM_142844.1  CG7031-RA (CG7031), mRNA 
0   NM_132005.1  CG15780-RA (CG15780), mRNA 
0   NM_140729.1  CG13733-RA (CG13733), mRNA 
0   19  47  NM_079827.2  CG7788-RA (Ice), mRNA 
0   NM_141113.2  CG7442-RA (CG7442), mRNA 
0   NM_167803.1  CG18374-RB, transcript variant B (Gyk), mRNA 
0   NM_079916.2  CG18374-RA, transcript variant A (Gyk), mRNA 
0   NM_136485.2  CG30377-RA (CG30377), mRNA 
0   NM_143973.2  CG17278-RA (CG17278), mRNA 
0   NM_001014526.1  CG33528-RE, transcript variant E (CG33528), mRNA 
0   NM_001014525.1  CG33528-RD, transcript variant D (CG33528), mRNA 
0   NM_001014524.1  CG33528-RC, transcript variant C (CG33528), mRNA 
0   NM_132588.1  CG15728-RA (CG15728), mRNA 
0   NM_169358.1  CG14685-RA, transcript variant A (Cap-H2), mRNA 
0   NM_141757.1  CG14685-RB, transcript variant B (Cap-H2), mRNA 
0   NM_001032022.1  CG11779-RD, transcript variant D (CG11779), mRNA 
0   NM_001032023.1  CG11779-RC, transcript variant C (CG11779), mRNA 
0   NM_169849.1  CG11779-RB, transcript variant B (CG11779), mRNA 
0   NM_142529.3  CG11779-RA, transcript variant A (CG11779), mRNA 
0   10  13  NM_138229.1  CG13908-RA (CG13908), mRNA 
0   10  NM_143765.2  CG12218-RA (mei-P26), mRNA 
0   10  NM_142053.1  CG14366-RA (CG14366), mRNA 
0   NM_141590.2  CG11964-RA (CG11964), mRNA 
0   NM_141665.2  CG8348-RA (Dh), mRNA 
0   NM_080081.2  CG11450-RA (net), mRNA 
0   NM_167274.1  CG1938-RD, transcript variant D (Dlic2), mRNA 
0   NM_132466.2  CG1938-RA, transcript variant A (Dlic2), mRNA 
0   NM_167273.1  CG1938-RC, transcript variant C (Dlic2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.