National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5336R-3 
 Symbol Ced-12  Full Name Ced-12 
 CG No CG5336  Old CG No CG5336 
 Synonyms ELMO, CG5336, Dced-12, Ced-12, ced-12, dced-12 
 Accession No (Link to NCBI) NM_135704.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ishimaru S, Ueda R, Hinohara Y, Ohtani M, Hanafusa H.
PVR plays a critical role via JNK activation in thorax closure during Drosophila metamorphosis.
EMBO J. (2004) 23(20) 3984-94 [ PubMed ID = 15457211 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGAAAATAGCCGTGGAGCGAG 
 Primer Seq. 3'
aatctagaggtaccGTTGCGGGCCACGAATGAGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGAAAATAGC CGTGGAGCGA GAGGACCATA TAGCGCAGTT GATAAATCTG GATCAAAGGC 
0061 ATCCGCTGGC AAGTAAAATC CAGGAAATTT GCAATGGTTG GTCCATCAGC GATCACCAGA 
0121 ACTATGCACT CCAGTTCTAC GAGCCCACTA ACCGAAAGTA CGTGACCGAA AAGAATCGCA 
0181 ATGAGATCAA GAATGGCTCC GTACTGCAGC TGCAGTATTC GCCATCCAAG ACTGCCTGCG 
0241 ATGCCATGGA GGTGCTGCTC AATGGCAGTC CACAGGAGAA GGCGCTGCGT CTAAAGGAGC 
0301 TCACTTCCCT AAGCACCGAT CACACATTTG CCCTGGAGTT CATCAAGGAG AAGGGTCTCG 
0361 ACACACTCAT TAAGATGATC GAGGATGGCG GCCAGACCAA CGAAGACATT CTGAAATACA 
0421 GCCTGGCCAG CTTTGTGGAG CTGATGGAGC ACGGCACGGT GTCCTGGGAG GTGCCGGAAA 
0481 ACTCATTCGT GGcCCGCAAC  
 in silico PCR Fragment
0001 TGAAAATAGC CGTGGAGCGA GAGGACCATA TAGCGCAGTT GATAAATCTG GATCAAAGGC 
0061 ATCCGCTGGC AAGTAAAATC CAGGAAATTT GCAATGGTTG GTCCATCAGC GATCACCAGA 
0121 ACTATGCACT CCAGTTCTAC GAGCCCACTA ACCGAAAGTA CGTGACCGAA AAGAATCGCA 
0181 ATGAGATCAA GAATGGCTCC GTACTGCAGC TGCAGTATTC GCCATCCAAG ACTGCCTGCG 
0241 ATGCCATGGA GGTGCTGCTC AATGGCAGTC CACAGGAGAA GGCGCTGCGT CTAAAGGAGC 
0301 TCACTTCCCT AAGCACCGAT CACACATTTG CCCTGGAGTT CATCAAGGAG AAGGGTCTCG 
0361 ACACACTCAT TAAGATGATT GAGGATGGCG GCCAGACCAA CGAAGACATT CTGAAATACA 
0421 GCCTGGCCAG CTTTGTGGAG CTGATGGAGC ACGGCACGGT GTCCTGGGAG GTGCCGGAAA 
0481 ACTCATTCGT GGCCCGCAAC  
 Assemble Data

5336R-3.IR_full       1   TGAAAATAGCCGTGGAGCGAGAGGACCATATAGCGCAGTTGATAAATCTGGATCAAAGGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5336R-3.in silico     1   TGAAAATAGCCGTGGAGCGAGAGGACCATATAGCGCAGTTGATAAATCTGGATCAAAGGC 60


5336R-3.IR_full       61  ATCCGCTGGCAAGTAAAATCCAGGAAATTTGCAATGGTTGGTCCATCAGCGATCACCAGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5336R-3.in silico     61  ATCCGCTGGCAAGTAAAATCCAGGAAATTTGCAATGGTTGGTCCATCAGCGATCACCAGA 120


5336R-3.IR_full       121 ACTATGCACTCCAGTTCTACGAGCCCACTAACCGAAAGTACGTGACCGAAAAGAATCGCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5336R-3.in silico     121 ACTATGCACTCCAGTTCTACGAGCCCACTAACCGAAAGTACGTGACCGAAAAGAATCGCA 180


5336R-3.IR_full       181 ATGAGATCAAGAATGGCTCCGTACTGCAGCTGCAGTATTCGCCATCCAAGACTGCCTGCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5336R-3.in silico     181 ATGAGATCAAGAATGGCTCCGTACTGCAGCTGCAGTATTCGCCATCCAAGACTGCCTGCG 240


5336R-3.IR_full       241 ATGCCATGGAGGTGCTGCTCAATGGCAGTCCACAGGAGAAGGCGCTGCGTCTAAAGGAGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5336R-3.in silico     241 ATGCCATGGAGGTGCTGCTCAATGGCAGTCCACAGGAGAAGGCGCTGCGTCTAAAGGAGC 300


5336R-3.IR_full       301 TCACTTCCCTAAGCACCGATCACACATTTGCCCTGGAGTTCATCAAGGAGAAGGGTCTCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5336R-3.in silico     301 TCACTTCCCTAAGCACCGATCACACATTTGCCCTGGAGTTCATCAAGGAGAAGGGTCTCG 360


5336R-3.IR_full       361 ACACACTCATTAAGATGATCGAGGATGGCGGCCAGACCAACGAAGACATTCTGAAATACA 420
                          ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
5336R-3.in silico     361 ACACACTCATTAAGATGATTGAGGATGGCGGCCAGACCAACGAAGACATTCTGAAATACA 420


5336R-3.IR_full       421 GCCTGGCCAGCTTTGTGGAGCTGATGGAGCACGGCACGGTGTCCTGGGAGGTGCCGGAAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5336R-3.in silico     421 GCCTGGCCAGCTTTGTGGAGCTGATGGAGCACGGCACGGTGTCCTGGGAGGTGCCGGAAA 480


5336R-3.IR_full       481 ACTCATTCGTGGCCCGCAAC 500
                          ||||||||||||||||||||
5336R-3.in silico     481 ACTCATTCGTGGCCCGCAAC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135704.2  CG5336-RA (Ced-12), mRNA 
0.62   NM_143153.2  CG4719-RA (tankyrase), mRNA 
0   NM_058135.2  CG10917-RA (fj), mRNA 
0   NM_132488.3  CG11727-RB, transcript variant B (CG11727), mRNA 
0   NM_167285.2  CG11727-RA, transcript variant A (CG11727), mRNA 
0   NM_078489.1  CG3319-RA (Cdk7), mRNA 
0   NM_141515.2  CG7602-RA, transcript variant A (DNApol-iota), mRNA 
0   NM_057738.3  CG3969-RA, transcript variant A (PR2), mRNA 
0   NM_057739.3  CG3969-RB, transcript variant B (PR2), mRNA 
0   NM_169207.1  CG7602-RB, transcript variant B (DNApol-iota), mRNA 
0   NM_134690.2  CG2807-RA (CG2807), mRNA 
0   NM_166029.1  CG30482-RA (CG30482), mRNA 
0   NM_135958.3  CG5996-RA, transcript variant A (trpgamma), mRNA 
0   NM_165169.3  CG5996-RB, transcript variant B (trpgamma), mRNA 
0   NM_057341.3  CG10930-RA (PpY-55A), mRNA 
0   NM_132456.1  CG11126-RA (CG11126), mRNA 
0   NM_139862.2  CG18417-RA (CG18417), mRNA 
0   NM_134876.1  CG18558-RA (CG18558), mRNA 
0   NM_079998.2  CG5912-RA (arr), mRNA 
0   NM_168817.1  CG8533-RB, transcript variant B (CG8533), mRNA 
0   NM_140891.1  CG8533-RA, transcript variant A (CG8533), mRNA 
0   NM_168818.1  CG8533-RC, transcript variant C (CG8533), mRNA 
0   NM_078545.2  CG12653-RA (btd), mRNA 
0   NM_078761.3  CG7234-RI (GluRIIB), mRNA 
0   NM_165694.1  CG18345-RB, transcript variant B (trpl), mRNA 
0   NM_057547.3  CG18345-RA, transcript variant A (trpl), mRNA 
0   NM_165695.1  CG18345-RC, transcript variant C (trpl), mRNA 
0   NM_168756.1  CG8127-RC, transcript variant C (Eip75B), mRNA 
0   NM_079409.2  CG8127-RA, transcript variant A (Eip75B), mRNA 
0   NM_168755.1  CG8127-RB, transcript variant B (Eip75B), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.