National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5336R-2 
 Symbol Ced-12  Full Name Ced-12 
 CG No CG5336  Old CG No CG5336 
 Synonyms ELMO, CG5336, Dced-12, Ced-12, ced-12, dced-12 
 Accession No (Link to NCBI) NM_135704.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Ishimaru S, Ueda R, Hinohara Y, Ohtani M, Hanafusa H.
PVR plays a critical role via JNK activation in thorax closure during Drosophila metamorphosis.
EMBO J. (2004) 23(20) 3984-94 [ PubMed ID = 15457211 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGAAAATAGCCGTGGAGCGAGAGGACCATATAGCGCAGTTGATAAATCTGGATCAAAGGC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATCCGCTGGCAAGTAAAATCCAGGAAATTTGCAATGGTTGGTCCATCAGCGATCACCAGA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACTATGCACTCCAGTTCTACGAGCCCACTAACCGAAAGTACGTGACCGAAAAGAATCGCA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATGAGATCAAGAATGGCTCCGTACTGCAGCTGCAGTATTCGCCATCCAAGACTGCCTGCG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATGCCATGGAGGTGCTGCTCAATGGCAGTCCACAGGAGAAGGCGCTGCGTCTAAAGGAGC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCACTTCCCTAAGCACCGATCACACATTTGCCCTGGAGTTCATCAAGGAGAAGGGTCTCG 360

                          ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| silico     361 ACACACTCATTAAGATGATTGAGGATGGCGGCCAGACCAACGAAGACATTCTGAAATACA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCCTGGCCAGCTTTGTGGAGCTGATGGAGCACGGCACGGTGTCCTGGGAGGTGCCGGAAA 480

5336R-2.IR_full       481 ACTCATTCGTGGCCCGCAAC 500
                          |||||||||||||||||||| silico     481 ACTCATTCGTGGCCCGCAAC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135704.2  CG5336-RA (Ced-12), mRNA 
0.62   NM_143153.2  CG4719-RA (tankyrase), mRNA 
0   NM_058135.2  CG10917-RA (fj), mRNA 
0   NM_132488.3  CG11727-RB, transcript variant B (CG11727), mRNA 
0   NM_167285.2  CG11727-RA, transcript variant A (CG11727), mRNA 
0   NM_078489.1  CG3319-RA (Cdk7), mRNA 
0   NM_141515.2  CG7602-RA, transcript variant A (DNApol-iota), mRNA 
0   NM_057738.3  CG3969-RA, transcript variant A (PR2), mRNA 
0   NM_057739.3  CG3969-RB, transcript variant B (PR2), mRNA 
0   NM_169207.1  CG7602-RB, transcript variant B (DNApol-iota), mRNA 
0   NM_134690.2  CG2807-RA (CG2807), mRNA 
0   NM_166029.1  CG30482-RA (CG30482), mRNA 
0   NM_135958.3  CG5996-RA, transcript variant A (trpgamma), mRNA 
0   NM_165169.3  CG5996-RB, transcript variant B (trpgamma), mRNA 
0   NM_057341.3  CG10930-RA (PpY-55A), mRNA 
0   NM_132456.1  CG11126-RA (CG11126), mRNA 
0   NM_139862.2  CG18417-RA (CG18417), mRNA 
0   NM_134876.1  CG18558-RA (CG18558), mRNA 
0   NM_079998.2  CG5912-RA (arr), mRNA 
0   NM_168817.1  CG8533-RB, transcript variant B (CG8533), mRNA 
0   NM_140891.1  CG8533-RA, transcript variant A (CG8533), mRNA 
0   NM_168818.1  CG8533-RC, transcript variant C (CG8533), mRNA 
0   NM_078545.2  CG12653-RA (btd), mRNA 
0   NM_078761.3  CG7234-RI (GluRIIB), mRNA 
0   NM_165694.1  CG18345-RB, transcript variant B (trpl), mRNA 
0   NM_057547.3  CG18345-RA, transcript variant A (trpl), mRNA 
0   NM_165695.1  CG18345-RC, transcript variant C (trpl), mRNA 
0   NM_168756.1  CG8127-RC, transcript variant C (Eip75B), mRNA 
0   NM_079409.2  CG8127-RA, transcript variant A (Eip75B), mRNA 
0   NM_168755.1  CG8127-RB, transcript variant B (Eip75B), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.