National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5287R-4 
 Symbol CG5287  Full Name CG5287 
 CG No CG5287  Old CG No CG5287 
 Synonyms CG5287 
 Accession No (Link to NCBI) NM_135764.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTTCATACCGATTCCCTTCGC 
 Primer Seq. 3'
aatctagaggtaccTCATGCCGGCAAAGTAGCAGT 
 Predicted Fragment Size
590 
 IR fragment full Seq
0001 GTTCATACCG ATTCCCTTCG CCTTCGACGA GGCAGCTGCC ACGGATGCGA TTACTGGAGG 
0061 CAAACCAGAT ACCTTTCCAC ATGATAAGTT CGTGGAATTG ATTGCCGCCC TTCTTTCCAT 
0121 TTGCTGCATG ATCTTCTTGG GCTTCGCCGA TGACGTTCTC GACCTGCGAT GGCGCCACAA 
0181 GCTCCTGTTG CCCACCATCG CCACGTTGCC GCTGCTAATG GTGTACTACG TAAACTATAA 
0241 CTCCACGACG GTCATTATGC CCAACTTTGC AAGGAATCTG ATTGGGACCT CCTTGAATAT 
0301 AGGTGCCTTG TACTACGTCT TCATGGGCAT GTTGGCGGTA TTCTGCACAA ATGCCATCAA 
0361 CATCCTGGCG GGCATCAATG GCCTGGAGGT GGGACAATCC TTGATTATTG CAGGCTCCAT 
0421 TCTGGTCTTC AATGCCATTG AACTGTTGCT CGGTCACCAG GTGGATTCGC ATATATTCTC 
0481 CATTTACTTC ATGCTGCCTT TCCTGGCCAC CACCCTAGCG CTATGGAAGT TCAACAAATA 
0541 TCCATCGCAG GTGTTTGTTG GGGACACCTA CTGCTACTTT GGCCGGCATG A 
 in silico PCR Fragment
0001 GTTCATACCG ATTCCCTTCG CCTTCGACGA GGCAGCTGCC ACGGATGCGA TTACTGGAGG 
0061 CAAACCAGAT ACCTTTCCAC ATGATAAGTT CGTGGAATTG ATTGCCGCCC TTCTTTCCAT 
0121 TTGCTGCATG ATCTTCTTGG GCTTCGCCGA TGACGTTCTC GACCTGCGAT GGCGCCACAA 
0181 GCTCCTGTTG CCCACCATCG CCACGTTGCC GCTGCTAATG GTGTACTACG TAAACTATAA 
0241 CTCCACGACG GTCATTATGC CCAACTTTGC AAGGAATCTG ATTGGGACCT CCTTGAATAT 
0301 AGGTGCCTTG TACTACGTCT TCATGGGCAT GTTGGCGGTA TTCTGCACAA ATGCCATCAA 
0361 CATCCTGGCG GGCATCAATG GCCTGGAGGT GGGACAATCC TTTATTATTG CAGGCTCCAT 
0421 TCTGGTCTTC AATGCCATTG AACTGTTGCT CGGTCACCAG GTGGATTCGC ATATATTCTC 
0481 CATTTACTTC ATGCTGCCTT TCCTGGCCAC CACCCTAGCG CTATGGAAGT TCAACAAATA 
0541 TCCATCGCAG GTGTTTGTTG GGGACACCTA CTGCTACTTT -GCCGGCATG A 
 Assemble Data

5287R-4.IR_full       1   GTTCATACCGATTCCCTTCGCCTTCGACGAGGCAGCTGCCACGGATGCGATTACTGGAGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5287R-4.in silico     1   GTTCATACCGATTCCCTTCGCCTTCGACGAGGCAGCTGCCACGGATGCGATTACTGGAGG 60


5287R-4.IR_full       61  CAAACCAGATACCTTTCCACATGATAAGTTCGTGGAATTGATTGCCGCCCTTCTTTCCAT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5287R-4.in silico     61  CAAACCAGATACCTTTCCACATGATAAGTTCGTGGAATTGATTGCCGCCCTTCTTTCCAT 120


5287R-4.IR_full       121 TTGCTGCATGATCTTCTTGGGCTTCGCCGATGACGTTCTCGACCTGCGATGGCGCCACAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5287R-4.in silico     121 TTGCTGCATGATCTTCTTGGGCTTCGCCGATGACGTTCTCGACCTGCGATGGCGCCACAA 180


5287R-4.IR_full       181 GCTCCTGTTGCCCACCATCGCCACGTTGCCGCTGCTAATGGTGTACTACGTAAACTATAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5287R-4.in silico     181 GCTCCTGTTGCCCACCATCGCCACGTTGCCGCTGCTAATGGTGTACTACGTAAACTATAA 240


5287R-4.IR_full       241 CTCCACGACGGTCATTATGCCCAACTTTGCAAGGAATCTGATTGGGACCTCCTTGAATAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5287R-4.in silico     241 CTCCACGACGGTCATTATGCCCAACTTTGCAAGGAATCTGATTGGGACCTCCTTGAATAT 300


5287R-4.IR_full       301 AGGTGCCTTGTACTACGTCTTCATGGGCATGTTGGCGGTATTCTGCACAAATGCCATCAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5287R-4.in silico     301 AGGTGCCTTGTACTACGTCTTCATGGGCATGTTGGCGGTATTCTGCACAAATGCCATCAA 360


5287R-4.IR_full       361 CATCCTGGCGGGCATCAATGGCCTGGAGGTGGGACAATCCTTGATTATTGCAGGCTCCAT 420
                          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
5287R-4.in silico     361 CATCCTGGCGGGCATCAATGGCCTGGAGGTGGGACAATCCTTTATTATTGCAGGCTCCAT 420


5287R-4.IR_full       421 TCTGGTCTTCAATGCCATTGAACTGTTGCTCGGTCACCAGGTGGATTCGCATATATTCTC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5287R-4.in silico     421 TCTGGTCTTCAATGCCATTGAACTGTTGCTCGGTCACCAGGTGGATTCGCATATATTCTC 480


5287R-4.IR_full       481 CATTTACTTCATGCTGCCTTTCCTGGCCACCACCCTAGCGCTATGGAAGTTCAACAAATA 540
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5287R-4.in silico     481 CATTTACTTCATGCTGCCTTTCCTGGCCACCACCCTAGCGCTATGGAAGTTCAACAAATA 540


5287R-4.IR_full       541 TCCATCGCAGGTGTTTGTTGGGGACACCTACTGCTACTTTGGCCGGCATGA 591
                          |||||||||||||||||||||||||||||||||||||||| ||||||||||
5287R-4.in silico     541 TCCATCGCAGGTGTTTGTTGGGGACACCTACTGCTACTTT-GCCGGCATGA 591

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   572  NM_135764.3  CG5287-RA (CG5287), mRNA 
0   NM_169902.1  CG5191-RC, transcript variant C (CG5191), mRNA 
0   NM_057285.3  CG4965-RA (twe), mRNA 
0   NM_079007.2  CG17716-RA (fas), mRNA 
0   NM_139882.1  CG7716-RA (CG7716), mRNA 
0   NM_166137.1  CG8405-RA (CG8405), mRNA 
0   NM_078717.2  CG3696-RA, transcript variant A (kis), mRNA 
0   NM_001043041.1  CG17800-PBE (Dscam), mRNA 
0   NM_001043033.1  CG17800-RO, transcript variant O (Dscam), mRNA 
0   NM_001043055.1  CG17800-RL, transcript variant L (Dscam), mRNA 
0   12  NM_001043208.1  CG41467-RA, transcript variant A (CG41467), mRNA 
0   NM_139357.2  CG13788-RA, transcript variant A (Gr28b), mRNA 
0   NM_145882.1  CG30148-RA (CG30148), mRNA 
0   NM_132852.1  CG8565-RA (CG8565), mRNA 
0   NM_164376.1  CG3696-RB, transcript variant B (kis), mRNA 
0   NM_205921.1  CG13788-RB, transcript variant B (Gr28b), mRNA 
0   NM_205920.1  CG13788-RC, transcript variant C (Gr28b), mRNA 
0   NM_205919.1  CG13788-RD, transcript variant D (Gr28b), mRNA 
0   NM_205918.1  CG13788-RE, transcript variant E (Gr28b), mRNA 
0   NM_137277.2  CG7989-RA (l(2)k07824), mRNA 
0   NM_134721.2  CG4644-RA (CG4644), mRNA 
0   NM_164738.1  CG13777-RB, transcript variant B (milt), mRNA 
0   NM_164736.1  CG13777-RA, transcript variant A (milt), mRNA 
0   NM_080765.2  CG13777-RC, transcript variant C (milt), mRNA 
0   NM_170412.1  CG2010-RA, transcript variant A (CG2010), mRNA 
0   NM_001043207.1  CG41467-RB, transcript variant B (CG41467), mRNA 
0   NM_141101.1  CG14566-RA (CG14566), mRNA 
0   NM_143439.2  CG2010-RB, transcript variant B (CG2010), mRNA 
0   NM_168608.1  CG16959-RB, transcript variant B (CG16959), mRNA 
0   NM_140493.2  CG16959-RA, transcript variant A (CG16959), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.