National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5287R-1 
 Symbol CG5287  Full Name CG5287 
 CG No CG5287  Old CG No CG5287 
 Synonyms CG5287 
 Accession No (Link to NCBI) NM_135764.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GTTCATACCGATTCCCTTCGCCTTCGACGAGGCAGCTGCCACGGATGCGATTACTGGAGG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CAAACCAGATACCTTTCCACATGATAAGTTCGTGGAATTGATTGCCGCCCTTCTTTCCAT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TTGCTGCATGATCTTCTTGGGCTTCGCCGATGACGTTCTCGACCTGCGATGGCGCCACAA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCTCCTGTTGCCCACCATCGCCACGTTGCCGCTGCTAATGGTGTACTACGTAAACTATAA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CTCCACGACGGTCATTATGCCCAACTTTGCAAGGAATCTGATTGGGACCTCCTTGAATAT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGGTGCCTTGTACTACGTCTTCATGGGCATGTTGGCGGTATTCTGCACAAATGCCATCAA 360

                          |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| silico     361 CATCCTGGCGGGCATCAATGGCCTGGAGGTGGGACAATCCTTTATTATTGCAGGCTCCAT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TCTGGTCTTCAATGCCATTGAACTGTTGCTCGGTCACCAGGTGGATTCGCATATATTCTC 480

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     481 CATTTACTTCATGCTGCCTTTCCTGGCCACCACCCTAGCGCTATGGAAGTTCAACAAATA 540

                          |||||||||||||||||||||||||||||||||||||||| |||||||||| silico     541 TCCATCGCAGGTGTTTGTTGGGGACACCTACTGCTACTTT-GCCGGCATGA 591

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   572  NM_135764.3  CG5287-RA (CG5287), mRNA 
0   NM_169902.1  CG5191-RC, transcript variant C (CG5191), mRNA 
0   NM_057285.3  CG4965-RA (twe), mRNA 
0   NM_079007.2  CG17716-RA (fas), mRNA 
0   NM_139882.1  CG7716-RA (CG7716), mRNA 
0   NM_166137.1  CG8405-RA (CG8405), mRNA 
0   NM_078717.2  CG3696-RA, transcript variant A (kis), mRNA 
0   NM_001043041.1  CG17800-PBE (Dscam), mRNA 
0   NM_001043033.1  CG17800-RO, transcript variant O (Dscam), mRNA 
0   NM_001043055.1  CG17800-RL, transcript variant L (Dscam), mRNA 
0   12  NM_001043208.1  CG41467-RA, transcript variant A (CG41467), mRNA 
0   NM_139357.2  CG13788-RA, transcript variant A (Gr28b), mRNA 
0   NM_145882.1  CG30148-RA (CG30148), mRNA 
0   NM_132852.1  CG8565-RA (CG8565), mRNA 
0   NM_164376.1  CG3696-RB, transcript variant B (kis), mRNA 
0   NM_205921.1  CG13788-RB, transcript variant B (Gr28b), mRNA 
0   NM_205920.1  CG13788-RC, transcript variant C (Gr28b), mRNA 
0   NM_205919.1  CG13788-RD, transcript variant D (Gr28b), mRNA 
0   NM_205918.1  CG13788-RE, transcript variant E (Gr28b), mRNA 
0   NM_137277.2  CG7989-RA (l(2)k07824), mRNA 
0   NM_134721.2  CG4644-RA (CG4644), mRNA 
0   NM_164738.1  CG13777-RB, transcript variant B (milt), mRNA 
0   NM_164736.1  CG13777-RA, transcript variant A (milt), mRNA 
0   NM_080765.2  CG13777-RC, transcript variant C (milt), mRNA 
0   NM_170412.1  CG2010-RA, transcript variant A (CG2010), mRNA 
0   NM_001043207.1  CG41467-RB, transcript variant B (CG41467), mRNA 
0   NM_141101.1  CG14566-RA (CG14566), mRNA 
0   NM_143439.2  CG2010-RB, transcript variant B (CG2010), mRNA 
0   NM_168608.1  CG16959-RB, transcript variant B (CG16959), mRNA 
0   NM_140493.2  CG16959-RA, transcript variant A (CG16959), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.