National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5216R-2 
 Symbol Sir2  Full Name Sir2 
 CG No CG5216  Old CG No CG5216 
 Synonyms dSir2, DSir2, SIR2, Sir2L, dsir2, dmSRT406, CG5216, dSIR2, D.mel1, BEST:LD38188, l(2)05326, Sir2 
 Accession No (Link to NCBI) NM_058003.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Avery MA, Sheehan AE, Kerr KS, Wang J, Freeman MR.
Wld S requires Nmnat1 enzymatic activity and N16-VCP interactions to suppress Wallerian degeneration.
J. Cell Biol. (2009) 184(4) 501-13 [ PubMed ID = 19237597 ] [ RRC reference ]

Kusama S, Ueda R, Suda T, Nishihara S, Matsuura ET.
Involvement of Drosophila Sir2-like genes in the regulation of life span.
Genes Genet. Syst. (2006) 81(5) 341-8 [ PubMed ID = 17159295 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGGGCCACATTAGGTCTAAA 
 Primer Seq. 3'
aatctagaggtaccGCGAAATGCGGCATAATGCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CNGGGcCACA TTAGGTCTAA AGATCTGGGC AACCAGGTGC CAGACACTAC GCAATTCTAT 
0061 CCGCCAACTA AGTTTGATTT TGGCGCGGAA ATTCTGGCCT CAACGTCAAc agaggCAGAG 
0121 GCAGAGGCAG AAGCAACAGC AACAACCACA GAACCAGCAA CAAGCGAACT TGCTGGCAAA 
0181 GCAAATGGTG AAATCAAAAC AAAAACATTG GCTGCCAGGG AAGAACAAGA GATTGGCGCC 
0241 AATTTGGAGC ATAAAACCAA AAATCCCACA AAGTCAATGG GCGAGGATGA AGATGACGAG 
0301 GAGGAGGAGG AAGAGGACGA TGAGGAGGAG GAGGAGGACG ACGAGGAGGG AATCACCGGA 
0361 ACGAGCAACG AGGATGAGGA CTCCAGCTCA AATTGCTCCT CATCCGTGGA ACCCGACTGG 
0421 AAGCTGCGCT GGTTGCAACG AGAATTTTAC ACAGGTCGTG TGCCGCGCCA GGTTATTGCC 
0481 AGCATTATGC CGCATTTCGC  
 in silico PCR Fragment
0001 CTGGGCCACA TTAGGTCTAA AGATCTGGGC AACCAGGTGC CAGACACTAC GCAATTCTAT 
0061 CCGCCAACTA AGTTTGATTT TGGCGCGGAA ATTCTGGCCT CAACGTCAAC AGAGGCAGAG 
0121 GCAGAGGCAG AAGCAACAGC AACAACCACA GAACCAGCAA CAAGCGAACT TGCTGGCAAA 
0181 GCAAATGGTG AAATCAAAAC AAAAACATTG GCTGCCAGGG AAGAACAAGA GATTGGCGCC 
0241 AATTTGGAGC ATAAAACCAA AAATCCCACA AAGTCAATGG GCGAGGATGA AGATGACGAG 
0301 GAGGAGGAGG AAGAGGACGA TGAGGAGGAG GAGGAGGACG ACGAGGAGGG AATCACCGGA 
0361 ACGAGCAACG AGGATGAGGA CTCCAGCTCA AATTGCTCCT CATCCGTGGA ACCCGACTGG 
0421 AAGCTGCGCT GGTTGCAACG AGAATTTTAC ACAGGTCGTG TGCCGCGCCA GGTTATTGCC 
0481 AGCATTATGC CGCATTTCGC  
 Assemble Data

5216R-2.IR_full       1   CNGGGCCACATTAGGTCTAAAGATCTGGGCAACCAGGTGCCAGACACTACGCAATTCTAT 60
                          | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5216R-2.in silico     1   CTGGGCCACATTAGGTCTAAAGATCTGGGCAACCAGGTGCCAGACACTACGCAATTCTAT 60


5216R-2.IR_full       61  CCGCCAACTAAGTTTGATTTTGGCGCGGAAATTCTGGCCTCAACGTCAACAGAGGCAGAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5216R-2.in silico     61  CCGCCAACTAAGTTTGATTTTGGCGCGGAAATTCTGGCCTCAACGTCAACAGAGGCAGAG 120


5216R-2.IR_full       121 GCAGAGGCAGAAGCAACAGCAACAACCACAGAACCAGCAACAAGCGAACTTGCTGGCAAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5216R-2.in silico     121 GCAGAGGCAGAAGCAACAGCAACAACCACAGAACCAGCAACAAGCGAACTTGCTGGCAAA 180


5216R-2.IR_full       181 GCAAATGGTGAAATCAAAACAAAAACATTGGCTGCCAGGGAAGAACAAGAGATTGGCGCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5216R-2.in silico     181 GCAAATGGTGAAATCAAAACAAAAACATTGGCTGCCAGGGAAGAACAAGAGATTGGCGCC 240


5216R-2.IR_full       241 AATTTGGAGCATAAAACCAAAAATCCCACAAAGTCAATGGGCGAGGATGAAGATGACGAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5216R-2.in silico     241 AATTTGGAGCATAAAACCAAAAATCCCACAAAGTCAATGGGCGAGGATGAAGATGACGAG 300


5216R-2.IR_full       301 GAGGAGGAGGAAGAGGACGATGAGGAGGAGGAGGAGGACGACGAGGAGGGAATCACCGGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5216R-2.in silico     301 GAGGAGGAGGAAGAGGACGATGAGGAGGAGGAGGAGGACGACGAGGAGGGAATCACCGGA 360


5216R-2.IR_full       361 ACGAGCAACGAGGATGAGGACTCCAGCTCAAATTGCTCCTCATCCGTGGAACCCGACTGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5216R-2.in silico     361 ACGAGCAACGAGGATGAGGACTCCAGCTCAAATTGCTCCTCATCCGTGGAACCCGACTGG 420


5216R-2.IR_full       421 AAGCTGCGCTGGTTGCAACGAGAATTTTACACAGGTCGTGTGCCGCGCCAGGTTATTGCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5216R-2.in silico     421 AAGCTGCGCTGGTTGCAACGAGAATTTTACACAGGTCGTGTGCCGCGCCAGGTTATTGCC 480


5216R-2.IR_full       481 AGCATTATGCCGCATTTCGC 500
                          ||||||||||||||||||||
5216R-2.in silico     481 AGCATTATGCCGCATTTCGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  16  100  208  NM_058003.3  CG5216-RA (Sir2), mRNA 
7.67   37  NM_165025.1  CG9828-RB, transcript variant B (DnaJ-H), mRNA 
1.65   29  72  100  NM_143338.2  CG12259-RA (CG12259), mRNA 
1.65   10  37  99  NM_139852.2  CG8591-RA (CTCF), mRNA 
1.45   23  51  87  NM_132095.2  CG3918-RA (CG3918), mRNA 
1.03   27  102  228  NM_132346.1  CG3003-RB (CG3003), mRNA 
1.03   20  47  78  NM_079842.2  CG17958-RA (Sry-delta), mRNA 
1.03   18  108  304  NM_132012.1  CG15776-RA (CG15776), mRNA 
1.03   13  42  88  NM_132074.1  CG3585-RA (CG3585), mRNA 
1.03   48  154  NM_057951.2  CG9210-RA, transcript variant A (Ac13E), mRNA 
1.03   48  154  NM_001014745.1  CG9210-RB, transcript variant B (Ac13E), mRNA 
0.82   33  214  604  NM_001014737.1  CG7107-RG, transcript variant G (up), mRNA 
0.82   33  214  604  NM_080349.2  CG7107-RA, transcript variant A (up), mRNA 
0.82   33  214  604  NM_167375.1  CG7107-RB, transcript variant B (up), mRNA 
0.82   33  214  604  NM_001014738.1  CG7107-RF, transcript variant F (up), mRNA 
0.82   33  214  604  NM_167376.1  CG7107-RD, transcript variant D (up), mRNA 
0.82   33  214  597  NM_001014739.1  CG7107-RE, transcript variant E (up), mRNA 
0.82   29  86  114  NM_057368.3  CG2621-RD, transcript variant D (sgg), mRNA 
0.82   24  42  NM_166973.1  CG12206-RB, transcript variant B (CG12206), mRNA 
0.82   21  34  NM_166974.1  CG12206-RC, transcript variant C (CG12206), mRNA 
0.82   21  34  NM_130704.1  CG12206-RA, transcript variant A (CG12206), mRNA 
0.82   38  50  NM_142302.1  CG14890-RA (CG14890), mRNA 
0.82   20  60  NM_137686.5  CG9313-RA (CG9313), mRNA 
0.62   21  62  145  NM_080335.2  CG2984-RA (Pp2C1), mRNA 
0.62   18  49  NM_141594.1  CG11970-RA (CG11970), mRNA 
0.62   26  130  NM_136634.2  CG1975-RA (Rep2), mRNA 
0.62   34  151  NM_132267.4  CG12109-RB (Caf1-180), mRNA 
0.41   35  72  112  NM_143802.2  CG8013-RA, transcript variant A (Su(z)12), mRNA 
0.41   35  72  110  NM_168826.1  CG8013-RB, transcript variant B (Su(z)12), mRNA 
0.41   24  41  97  NM_080371.2  CG2040-RC, transcript variant C (hig), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.