National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 4 May to 11 May, deadline 21 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5183R-1 
 Symbol KdelR  Full Name KDEL receptor 
 CG No CG5183  Old CG No CG5183 
 Synonyms Erd2, dmErd2, l(2)k00311, ERD2, CK00230, CG5183, BEST:CK00230, KdelR 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Xu C, Franklin B, Tang HW, Regimbald-Dumas Y, Hu Y, Ramos J, Bosch JA, Villalta C, He X, Perrimon N.
An in vivo RNAi screen uncovers the role of AdoR signaling and adenosine deaminase in controlling intestinal stem cell activity.
Proc Natl Acad Sci U S A (2020) 117(1) 464-471 [ PubMed ID = 31852821 ] [ RRC reference ]

Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem Biophys Res Commun (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTATCTTTCGCTTTGCTGGGGA 
 Primer Seq. 3'
aatctagaggtaccGGTAGACCCAGTTGAGCAAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

5183R-1.IR full       1   TATCTTTCGCTTTGCTGGGGATCTGTCGCATGTGTTTGCCATCATAATACTGCTGCTGAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5183R-1.in silico     1   TATCTTTCGCTTTGCTGGGGATCTGTCGCATGTGTTTGCCATCATAATACTGCTGCTGAA 60


5183R-1.IR full       61  GATATGGAAGACCCGCTCGTGCGCCGGAATATCGGGCAAGTCGCAGATCCTGTTCGCCGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5183R-1.in silico     61  GATATGGAAGACCCGCTCGTGCGCCGGAATATCGGGCAAGTCGCAGATCCTGTTCGCCGT 120


5183R-1.IR full       121 GGTCTATCTGACGCGCTACCTGGATCTGTTCACCACCTACGTGAGCCTGTACAACTCGGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5183R-1.in silico     121 GGTCTATCTGACGCGCTACCTGGATCTGTTCACCACCTACGTGAGCCTGTACAACTCGGT 180


5183R-1.IR full       181 GATGAAGGTGTTGTTCCTGGCCACGTCCGGTGCCACCGTGTATTTGATGTACGTGAAGTT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5183R-1.in silico     181 GATGAAGGTGTTGTTCCTGGCCACGTCCGGTGCCACCGTGTATTTGATGTACGTGAAGTT 240


5183R-1.IR full       241 TAAGGCCACCTATGACCACAATCACGATTCGTTCCGCATCGAATTCCTGCTGGTGCCGTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5183R-1.in silico     241 TAAGGCCACCTATGACCACAATCACGATTCGTTCCGCATCGAATTCCTGCTGGTGCCGTG 300


5183R-1.IR full       301 CGCCCTGCTCTCGCTGGTGATCAATCATGAGTTTACCGTGATGGAAGTGCTGTGGACATT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5183R-1.in silico     301 CGCCCTGCTCTCGCTGGTGATCAATCATGAGTTTACCGTGATGGAAGTGCTGTGGACATT 360


5183R-1.IR full       361 CTCGATCTATCTGGAATCGGTGGCCATTCTGCCGCAGCTGTTCCTAGTGAGCAGAACCGG 420
                          |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
5183R-1.in silico     361 CTCGATCTATTTGGAATCGGTGGCCATTCTGCCGCAGCTGTTCCTAGTGAGCAGAACCGG 420


5183R-1.IR full       421 CGAGGCCGAGTCCATCACCAGCCACTACCTCTTCGCCCTGGGATCGTACCGTGCACTCTA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5183R-1.in silico     421 CGAGGCCGAGTCCATCACCAGCCACTACCTCTTCGCCCTGGGATCGTACCGTGCACTCTA 480


5183R-1.IR full       481 CTTGCTCAACTGGGTCTACC 500
                          ||||||||||||||||||||
5183R-1.in silico     481 CTTGCTCAACTGGGTCTACC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.