National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 4 May to 11 May, deadline 21 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5170R-1 
 Symbol Dp1  Full Name Dodeca-satellite-binding protein 1 
 CG No CG5170  Old CG No CG5170 
 Synonyms ddp1, CG5170, DDP1, BcDNA:LD21677, BcDNA:LD21383, anon-WO0172774.168, anon-WO0118547.516, Dp1 
 Accession No (Link to NCBI) NM_206164.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kohzaki H.
The function of replication and SCF complex during Drosophila wing development.
Front Biosci (Landmark Ed) (2018) 23 2235-2244 [ PubMed ID = 29772558 ] [ RRC reference ]

Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem Biophys Res Commun (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGCATCACGGTGCCCAAAGTT 
 Primer Seq. 3'
aatctagaggtaccCCTCCAGCTGCTTCATGTTGG 
 Predicted Fragment Size
499 
 IR fragment full Seq
0001 CGCATCACGG TGCCCAAAGT TTACCATCCC TTCATCGTGG GCCCCTACAG CGAGAACCTA 
0061 AATAAGCTGC AGGAGGAGAC CGGCGCTAGG ATCAACGTGC CGCCGCAGCA GGTTCAGAAG 
0121 GACGAGATCG TCATCTCGGG CGAGAAGGAC GCGGTCGCAG CGGCAAAGGC CAAGGTGGAG 
0181 GCCATTTACA AGGATATGGA AAAGAAGTGC TCTACCGTCA GTGTGGAGGT AGCTAAGCCC 
0241 AAGCACCGAT ATGTCATTGG TCCGAAGGGC TCCACCATCG CCGAGATTCT GCAGTTGACC 
0301 GGTGTGTCTG TAGAGATGCC TCCCAATGAC TCCCCCTCGG AGACGATCAC TTTGCGTGGG 
0361 CCGCAAGTGG CTTTGGGAAA TGCCCTAACC GTTGTCTACC AAAAGTCCAA CTCGGTCAAG 
0421 TCTGTGGAGA TCAATGCGGC ACATTGGATC CACAAGTATG TGATCGGTCG CAAGGGGGCC 
0481 AACATGAAGC AGCTGGAGG 
 in silico PCR Fragment
0001 CGCATCACGG TGCCCAAAGT TTACCATCCC TTCATCGTGG GCCCCTACAG CGAGAACCTA 
0061 AATAAGCTGC AGGAGGAGAC CGGCGCTAGG ATCAACGTGC CGCCGCAGCA GGTTCAGAAG 
0121 GACGAGATCG TCATCTCGGG CGAGAAGGAC GCGGTCGCAG CGGCAAAGGC CAAGGTGGAG 
0181 GCCATTTACA AGGATATGGA AAAGAAGTGC TCTACCGTCA GTGTGGAGGT AGCTAAGCCC 
0241 AAGCACCGAT ATGTCATTGG TCCGAAGGGC TCCACCATCG CCGAGATTCT GCAGTTGACC 
0301 GGTGTGTCTG TAGAGATGCC TCCCAATGAC TCCCCCTCGG AGACGATCAC TTTGCGTGGG 
0361 CCGCAAGTGG CTTTGGGAAA TGCCCTAACC GTTGTCTACC AAAAGTCCAA CTCGGTCAAG 
0421 TCTGTGGAGA TCAATGCGGC ACATTGGATC CACAAGTATG TGATCGGTCG CAAGGGGGCC 
0481 AACATGAAGC AGCTGGAGG 
 Assemble Data

5170R-1.IR_full       1   CGCATCACGGTGCCCAAAGTTTACCATCCCTTCATCGTGGGCCCCTACAGCGAGAACCTA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5170R-1.in silico     1   CGCATCACGGTGCCCAAAGTTTACCATCCCTTCATCGTGGGCCCCTACAGCGAGAACCTA 60


5170R-1.IR_full       61  AATAAGCTGCAGGAGGAGACCGGCGCTAGGATCAACGTGCCGCCGCAGCAGGTTCAGAAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5170R-1.in silico     61  AATAAGCTGCAGGAGGAGACCGGCGCTAGGATCAACGTGCCGCCGCAGCAGGTTCAGAAG 120


5170R-1.IR_full       121 GACGAGATCGTCATCTCGGGCGAGAAGGACGCGGTCGCAGCGGCAAAGGCCAAGGTGGAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5170R-1.in silico     121 GACGAGATCGTCATCTCGGGCGAGAAGGACGCGGTCGCAGCGGCAAAGGCCAAGGTGGAG 180


5170R-1.IR_full       181 GCCATTTACAAGGATATGGAAAAGAAGTGCTCTACCGTCAGTGTGGAGGTAGCTAAGCCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5170R-1.in silico     181 GCCATTTACAAGGATATGGAAAAGAAGTGCTCTACCGTCAGTGTGGAGGTAGCTAAGCCC 240


5170R-1.IR_full       241 AAGCACCGATATGTCATTGGTCCGAAGGGCTCCACCATCGCCGAGATTCTGCAGTTGACC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5170R-1.in silico     241 AAGCACCGATATGTCATTGGTCCGAAGGGCTCCACCATCGCCGAGATTCTGCAGTTGACC 300


5170R-1.IR_full       301 GGTGTGTCTGTAGAGATGCCTCCCAATGACTCCCCCTCGGAGACGATCACTTTGCGTGGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5170R-1.in silico     301 GGTGTGTCTGTAGAGATGCCTCCCAATGACTCCCCCTCGGAGACGATCACTTTGCGTGGG 360


5170R-1.IR_full       361 CCGCAAGTGGCTTTGGGAAATGCCCTAACCGTTGTCTACCAAAAGTCCAACTCGGTCAAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5170R-1.in silico     361 CCGCAAGTGGCTTTGGGAAATGCCCTAACCGTTGTCTACCAAAAGTCCAACTCGGTCAAG 420


5170R-1.IR_full       421 TCTGTGGAGATCAATGCGGCACATTGGATCCACAAGTATGTGATCGGTCGCAAGGGGGCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5170R-1.in silico     421 TCTGTGGAGATCAATGCGGCACATTGGATCCACAAGTATGTGATCGGTCGCAAGGGGGCC 480


5170R-1.IR_full       481 AACATGAAGCAGCTGGAGG 499
                          |||||||||||||||||||
5170R-1.in silico     481 AACATGAAGCAGCTGGAGG 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_206163.1  CG5170-RB, transcript variant B (Dp1), mRNA 
100   481  NM_079057.2  CG5170-RC, transcript variant C (Dp1), mRNA 
100   481  NM_206164.1  CG5170-RA, transcript variant A (Dp1), mRNA 
100   481  NM_166280.1  CG5170-RD, transcript variant D (Dp1), mRNA 
100   481  NM_166281.1  CG5170-RE, transcript variant E (Dp1), mRNA 
100   481  NM_166282.1  CG5170-RF, transcript variant F (Dp1), mRNA 
0.41   NM_001014742.1  CG6146-RC, transcript variant C (Top1), mRNA 
0.41   NM_078606.3  CG6146-RA, transcript variant A (Top1), mRNA 
0.41   NM_167435.2  CG6146-RB, transcript variant B (Top1), mRNA 
0.2   NM_057783.2  CG3954-RB, transcript variant B (csw), mRNA 
0   NM_140492.2  CG17081-RA (CG17081), mRNA 
0   NM_137689.2  CG3221-RA (CG3221), mRNA 
0   NM_079773.2  CG11853-RA (to), mRNA 
0   NM_165984.1  CG17034-RA, transcript variant A (CG17034), mRNA 
0   NM_137029.2  CG17034-RD, transcript variant D (CG17034), mRNA 
0   NM_170624.1  CG17034-RB, transcript variant B (CG17034), mRNA 
0   NM_170625.1  CG17034-RC, transcript variant C (CG17034), mRNA 
0   NM_132310.2  CG2194-RB, transcript variant B (Reg-3), mRNA 
0   NM_167182.1  CG2194-RC, transcript variant C (Reg-3), mRNA 
0   NM_132057.2  CG14447-RA (Grip), mRNA 
0   NM_079871.2  CG1775-RA, transcript variant A (Med), mRNA 
0   NM_170559.1  CG1775-RB, transcript variant B (Med), mRNA 
0   NM_206140.1  CG8912-RC, transcript variant C (Psi), mRNA 
0   NM_057775.3  CG8912-RB, transcript variant B (Psi), mRNA 
0   NM_166200.2  CG8912-RA, transcript variant A (Psi), mRNA 
0   NM_165853.1  CG13188-RA, transcript variant A (CG13188), mRNA 
0   NM_164818.1  CG13387-RA (emb), mRNA 
0   NM_142326.2  CG16941-RA (CG16941), mRNA 
0   NM_136870.1  CG13188-RB, transcript variant B (CG13188), mRNA 
0   NM_139386.2  CG7974-RA (CG7974), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.