National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5123R-3 
 Symbol Full Name Wrinkled 
 CG No CG5123  Old CG No CG5123 
 Synonyms hid, Hid, Hid1, HID, CG5123, l(3)05014, W 
 Accession No (Link to NCBI) NM_079412.2 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees thorax closure abnormal 
 Map Viewer
 Reference
[Please submit your publication]
Khammari A, Agn├Ęs F, Gandille P, Pret AM.
Physiological apoptosis of polar cells during Drosophila oogenesis is mediated by Hid-dependent regulation of Diap1.
Cell Death Differ. (2011) 18(5) 793-805 [ PubMed ID = 21113144 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCGTGCCCTTTTATTTGCCC 
 Primer Seq. 3'
aatctagaggtaccTGCTGCTGCCGGAAGAAGTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCCGTGCCCT TTTATTTGCC CGAGGGCGGC GCCGATGACG TAGCGTCGAG TTCATCGGGA 
0061 GCCTCGGGCA ACTCCTCCCC CCACAACCAC CCACTTCCCT CGAGCGCATC CTCGTCCGTC 
0121 TCCTCCTCGG GCGTGTCCTC GGCCTCCGCC TCCTCGGCCT CATCTTCGTC ATCCGCATCG 
0181 TCGGACGGCG CCAGCAGCGC CGCCTCGCAA TCGCCGAACA CCACCACCTC GTCGGCCACG 
0241 CAGACGCACG ATGCAGTCTC CACTGCCCAC CGACCAAGTG CTATACGCCC TCTACGAGTG 
0301 GGTCAGGATG TACCAGAGCC AGCAGAGTGC CCCGCAAATC TTCCAGTATC CGCCGCCAAG 
0361 CCCCTCTTGC AATTTCACTG GCGGCGATGT GTTCTTTCCG CACGGCCATC CGAATCCGAA 
0421 CTCGAATCCC CATCCGCGCA CCCCCCGAAC CAGCGTGAGC TTCTcCTCCG GCGAGGAGTA 
0481 CAACTTCTTC CGGCAGCAGC A 
 in silico PCR Fragment
0001 GCCGTGCCCT TTTATTTGCC CGAGGGCGGC GCCGATGACG TAGCGTCGAG TTCATCGGGA 
0061 GCCTCGGGCA ACTCCTCCCC CCACAACCAC CCACTTCCCT CGAGCGCATC CTCGTCCGTC 
0121 TCCTCCTCGG GCGTGTCCTC GGCCTCCGCC TCCTCGGCCT CATCTTCGTC CTCCGCATCG 
0181 TCGGACGGCG CCAGCAGCGC CGCCTCGCAA TCGCCGAACA CCACCACCTC GTCGGCCACG 
0241 CAGACGC-CG ATGCAGTCTC CACTGCCCAC CGACCAAGTG CTATACGCCC TCTACGAGTG 
0301 GGTCAGGATG TACCAGAGCC AGCAGAGTGC CCCGCAAATC TTCCAGTATC CGCCGCCAAG 
0361 CCCCTCTTGC AATTTCACGG GCGGCGATGT GTTCTTTCCG CACGGCCATC CGAATCCGAA 
0421 CTCGAATCCC CATCCGCGCA CCCCCCGAAC CAGCGTGAGC TTCTCCTCCG GCGAGGAGTA 
0481 CAACTTCTTC CGGCAGCAGC A 
 Assemble Data

5123R-3.IR_full       1   GCCGTGCCCTTTTATTTGCCCGAGGGCGGCGCCGATGACGTAGCGTCGAGTTCATCGGGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5123R-3.in silico     1   GCCGTGCCCTTTTATTTGCCCGAGGGCGGCGCCGATGACGTAGCGTCGAGTTCATCGGGA 60


5123R-3.IR_full       61  GCCTCGGGCAACTCCTCCCCCCACAACCACCCACTTCCCTCGAGCGCATCCTCGTCCGTC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5123R-3.in silico     61  GCCTCGGGCAACTCCTCCCCCCACAACCACCCACTTCCCTCGAGCGCATCCTCGTCCGTC 120


5123R-3.IR_full       121 TCCTCCTCGGGCGTGTCCTCGGCCTCCGCCTCCTCGGCCTCATCTTCGTCATCCGCATCG 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
5123R-3.in silico     121 TCCTCCTCGGGCGTGTCCTCGGCCTCCGCCTCCTCGGCCTCATCTTCGTCCTCCGCATCG 180


5123R-3.IR_full       181 TCGGACGGCGCCAGCAGCGCCGCCTCGCAATCGCCGAACACCACCACCTCGTCGGCCACG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5123R-3.in silico     181 TCGGACGGCGCCAGCAGCGCCGCCTCGCAATCGCCGAACACCACCACCTCGTCGGCCACG 240


5123R-3.IR_full       241 CAGACGCACGATGCAGTCTCCACTGCCCACCGACCAAGTGCTATACGCCCTCTACGAGTG 300
                          ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
5123R-3.in silico     241 CAGACGC-CGATGCAGTCTCCACTGCCCACCGACCAAGTGCTATACGCCCTCTACGAGTG 300


5123R-3.IR_full       301 GGTCAGGATGTACCAGAGCCAGCAGAGTGCCCCGCAAATCTTCCAGTATCCGCCGCCAAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5123R-3.in silico     301 GGTCAGGATGTACCAGAGCCAGCAGAGTGCCCCGCAAATCTTCCAGTATCCGCCGCCAAG 360


5123R-3.IR_full       361 CCCCTCTTGCAATTTCACTGGCGGCGATGTGTTCTTTCCGCACGGCCATCCGAATCCGAA 420
                          |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
5123R-3.in silico     361 CCCCTCTTGCAATTTCACGGGCGGCGATGTGTTCTTTCCGCACGGCCATCCGAATCCGAA 420


5123R-3.IR_full       421 CTCGAATCCCCATCCGCGCACCCCCCGAACCAGCGTGAGCTTCTCCTCCGGCGAGGAGTA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5123R-3.in silico     421 CTCGAATCCCCATCCGCGCACCCCCCGAACCAGCGTGAGCTTCTCCTCCGGCGAGGAGTA 480


5123R-3.IR_full       481 CAACTTCTTCCGGCAGCAGCA 501
                          |||||||||||||||||||||
5123R-3.in silico     481 CAACTTCTTCCGGCAGCAGCA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079412.2  CG5123-RA (W), mRNA 
0   23  NM_176460.1  CG31374-RC, transcript variant C (CG31374), mRNA 
0   23  NM_169390.2  CG31374-RB, transcript variant B (CG31374), mRNA 
0   15  NM_169391.1  CG31374-RA, transcript variant A (CG31374), mRNA 
0   32  NM_132831.1  CG8184-RB (CG8184), mRNA 
0   16  NM_132908.2  CG4453-RA (Nup153), mRNA 
0   15  NM_139508.2  CG32486-RD (CG32486), mRNA 
0   NM_135755.1  CG9932-RA (CG9932), mRNA 
0   14  NM_001038902.1  CG33993-RA (CG33993), mRNA 
0   17  NM_167210.1  CG32694-RC, transcript variant C (CG32694), mRNA 
0   17  NM_167209.1  CG32694-RA, transcript variant A (CG32694), mRNA 
0   NM_136882.2  CG30040-RA (jeb), mRNA 
0   NM_001015362.1  CG41101-PA.3 (CG41101), mRNA 
0   NM_141590.2  CG11964-RA (CG11964), mRNA 
0   NM_143422.1  CG11898-RA (CG11898), mRNA 
0   47  NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0   15  NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   14  NM_139725.2  CG5249-RA (Blimp-1), mRNA 
0   13  NM_166130.1  CG18255-RE, transcript variant E (Strn-Mlck), mRNA 
0   NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_134752.2  CG5561-RA (CG5561), mRNA 
0   NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   20  NM_001038965.1  CG9924-RE, transcript variant E (CG9924), mRNA 
0   15  NM_057773.3  CG7538-RA (Mcm2), mRNA 
0   NM_078689.2  CG14228-RA (Mer), mRNA 
0   NM_164605.1  CG8886-RB, transcript variant B (l(2)05714), mRNA 
0   NM_143776.3  CG8886-RA, transcript variant A (l(2)05714), mRNA 
0   NM_001014630.1  CG33547-RA (Rim), mRNA 
0   NM_169046.1  CG31538-RA (CG31538), mRNA 
0   NM_143281.1  CG6066-RA (CG6066), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.