National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5123R-2 
 Symbol Full Name Wrinkled 
 CG No CG5123  Old CG No CG5123 
 Synonyms hid, Hid, Hid1, HID, CG5123, l(3)05014, W 
 Accession No (Link to NCBI) NM_079412.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal, female abnormal notum/wing 
 Map Viewer
[Please submit your publication]
Khammari A, Agn├Ęs F, Gandille P, Pret AM.
Physiological apoptosis of polar cells during Drosophila oogenesis is mediated by Hid-dependent regulation of Diap1.
Cell Death Differ. (2011) 18(5) 793-805 [ PubMed ID = 21113144 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCCGTGCCCTTTTATTTGCCCGAGGGCGGCGCCGATGACGTAGCGTCGAGTTCATCGGGA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCCTCGGGCAACTCCTCCCCCCACAACCACCCACTTCCCTCGAGCGCATCCTCGTCCGTC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     121 TCCTCCTCGGGCGTGTCCTCGGCCTCCGCCTCCTCGGCCTCATCTTCGTCCTCCGCATCG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCGGACGGCGCCAGCAGCGCCGCCTCGCAATCGCCGAACACCACCACCTCGTCGGCCACG 240

                          ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CAGACGC-CGATGCAGTCTCCACTGCCCACCGACCAAGTGCTATACGCCCTCTACGAGTG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGTCAGGATGTACCAGAGCCAGCAGAGTGCCCCGCAAATCTTCCAGTATCCGCCGCCAAG 360

                          |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| silico     361 CCCCTCTTGCAATTTCACGGGCGGCGATGTGTTCTTTCCGCACGGCCATCCGAATCCGAA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CTCGAATCCCCATCCGCGCACCCCCCGAACCAGCGTGAGCTTCTCCTCCGGCGAGGAGTA 480

5123R-2.IR_full       481 CAACTTCTTCCGGCAGCAGCA 501
                          ||||||||||||||||||||| silico     481 CAACTTCTTCCGGCAGCAGCA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079412.2  CG5123-RA (W), mRNA 
0   23  NM_176460.1  CG31374-RC, transcript variant C (CG31374), mRNA 
0   23  NM_169390.2  CG31374-RB, transcript variant B (CG31374), mRNA 
0   15  NM_169391.1  CG31374-RA, transcript variant A (CG31374), mRNA 
0   32  NM_132831.1  CG8184-RB (CG8184), mRNA 
0   16  NM_132908.2  CG4453-RA (Nup153), mRNA 
0   15  NM_139508.2  CG32486-RD (CG32486), mRNA 
0   NM_135755.1  CG9932-RA (CG9932), mRNA 
0   14  NM_001038902.1  CG33993-RA (CG33993), mRNA 
0   17  NM_167210.1  CG32694-RC, transcript variant C (CG32694), mRNA 
0   17  NM_167209.1  CG32694-RA, transcript variant A (CG32694), mRNA 
0   NM_136882.2  CG30040-RA (jeb), mRNA 
0   NM_001015362.1  CG41101-PA.3 (CG41101), mRNA 
0   NM_141590.2  CG11964-RA (CG11964), mRNA 
0   NM_143422.1  CG11898-RA (CG11898), mRNA 
0   47  NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0   15  NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   14  NM_139725.2  CG5249-RA (Blimp-1), mRNA 
0   13  NM_166130.1  CG18255-RE, transcript variant E (Strn-Mlck), mRNA 
0   NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_134752.2  CG5561-RA (CG5561), mRNA 
0   NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   20  NM_001038965.1  CG9924-RE, transcript variant E (CG9924), mRNA 
0   15  NM_057773.3  CG7538-RA (Mcm2), mRNA 
0   NM_078689.2  CG14228-RA (Mer), mRNA 
0   NM_164605.1  CG8886-RB, transcript variant B (l(2)05714), mRNA 
0   NM_143776.3  CG8886-RA, transcript variant A (l(2)05714), mRNA 
0   NM_001014630.1  CG33547-RA (Rim), mRNA 
0   NM_169046.1  CG31538-RA (CG31538), mRNA 
0   NM_143281.1  CG6066-RA (CG6066), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.