National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  

Suspension of shipments during Golden Week Holidays: From 4 May to 11 May, deadline 21 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5112R-1 
 Symbol CG5112  Full Name CG5112 
 CG No CG5112  Old CG No CG5112 
 Synonyms CG5112 
 Accession No (Link to NCBI) NM_143143.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem Biophys Res Commun (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GTCATTTTGGAGCCACGTACTTGATGCCCTGCTGGCACTGGTCCACATCCTGAGCGATCG 60

                          |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| silico     61  CCTGCTGGAGTTCGTACTGGACTGGTATTTGGGCGAGCACAAGCGG-GTATCGGGTCCAC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGAGCCTGGAACAGCAGACGACGATTACGAAGAGCGCTGTGGAGTTGGCGCAACAGATAC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGGAACGCAGGCAGCGCAGTTACGACATAGTCAAGGCCTACTGTGAGCGAATCGAGAGCG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TTAATCGGGATCTCAATGCGGTGGTCGATGGCCCGTTTCCGGAGGCCTTGGACCAGGCAC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCGAAATCGATCGCAAGTTGGACGAAAAGGAGTACAGCGATGAGGATCTGCGGCGCCTGC 360

                          |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| silico     361 CCTTCCTAGGCGTACCCTTCTCCACCAAGGATAGCA-CCGCTGTGGCTGGGAGGCTACAC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ACACTGGGCCTGCTAGCAAGGAAATCGGAACGTTCGACCACGGATGCGGAATGCGTGCGC 480

5112R-1.IR_full       481 CTGATGAAGGAAAGTGGCGCCA 502
                          |||||||||||||||||||||| silico     481 CTGATGAAGGAAAGTGGCGCCA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143143.2  CG5112-RA (CG5112), mRNA 
0   NM_176283.1  CG7447-RB, transcript variant B (CG7447), mRNA 
0   NM_139641.2  CG7447-RA, transcript variant A (CG7447), mRNA 
0   NM_001043216.1  CG34113-RO, transcript variant O (CG34113), mRNA 
0   NM_001043217.1  CG34113-RP, transcript variant P (CG34113), mRNA 
0   NM_139426.2  CG1140-RA, transcript variant A (CG1140), mRNA 
0   NM_167928.1  CG1140-RB, transcript variant B (CG1140), mRNA 
0   NM_078735.4  CG15396-RA, transcript variant A (Gr23a), mRNA 
0   NM_135346.2  CG8460-RA (CG8460), mRNA 
0   NM_168037.1  CG32264-RA, transcript variant A (CG32264), mRNA 
0   NM_168038.1  CG32264-RD, transcript variant D (CG32264), mRNA 
0   NM_168039.1  CG32264-RB, transcript variant B (CG32264), mRNA 
0   NM_206268.1  CG32264-RC, transcript variant C (CG32264), mRNA 
0   NM_079097.1  CG9820-RA (Or59a), mRNA 
0   NM_168834.1  CG6933-RC, transcript variant C (CG6933), mRNA 
0   NM_137203.2  CG8192-RA (CG8192), mRNA 
0   NM_132385.2  CG2967-RA (CG2967), mRNA 
0   NM_142868.1  CG13830-RA (CG13830), mRNA 
0   NM_079298.2  CG7636-RA (mRpL2), mRNA 
0   NM_168833.1  CG6933-RB, transcript variant B (CG6933), mRNA 
0   NM_079214.2  CG5495-RA (Txl), mRNA 
0   NM_079617.3  CG7855-RA (timeout), mRNA 
0   NM_142493.2  CG7717-RA, transcript variant A (Mekk1), mRNA 
0   NM_169833.1  CG7717-RB, transcript variant B (Mekk1), mRNA 
0   NM_135287.1  CG13792-RA (CG13792), mRNA 
0   NM_165306.1  CG10186-RC, transcript variant C (CG10186), mRNA 
0   NM_132962.1  CG8945-RC (CG8945), mRNA 
0   NM_130714.1  CG13317-RA (Ilp7), mRNA 
0   NM_140331.2  CG10627-RA (CG10627), mRNA 
0   NM_165757.1  CG18408-RC, transcript variant C (CAP), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.