National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5112R-1 
 Symbol CG5112  Full Name CG5112 
 CG No CG5112  Old CG No CG5112 
 Synonyms CG5112 
 Accession No (Link to NCBI) NM_143143.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem. Biophys. Res. Commun. (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTCATTTTGGAGCCACGTACT 
 Primer Seq. 3'
aatctagaggtaccTGGCGCCACTTTCCTTCATCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTCATTTTGG AGCCACGTAC TTGATGCCCT GCTGGCACTG GTCCACATCC TGAGCGATCG 
0061 CCTGCTGGAG TTCGTACTGG ACTGGTATTT GGGCGAGCAC AAGCGGTGTA TCGGGTCCAC 
0121 CGAGCCTGGA ACAGCAGACG ACGATTACGA AGAGCGCTGT GGAGTTGGCG CAACAGATAC 
0181 GGGAACGCAG GCAGCGCAGT TACGACATAG TCAAGGCCTA CTGTGAGCGA ATCGAGAGCG 
0241 TTAATCGGGA TCTCAATGCG GTGGTCGATG GCCCGTTTCC GGAGGCCTTG GACCAGGCAC 
0301 GCGAAATCGA TCGCAAGTTG GACGAAAAGG AGTACAGCGA TGAGGATCTG CGGCGCCTGC 
0361 CCTTCCTAGG CGTACCCTTC TCCACCAAGG ATAGCANCCG CTGTGGCTGG GAGGCTACAC 
0421 ACACTGGGCC TGCTAGCAAG GAAATCGGAA CGTTCGACCA CGGATGCGGA ATGCGTGCGC 
0481 CTGATGAAGG AAAGTGGCGC CA 
 in silico PCR Fragment
0001 GTCATTTTGG AGCCACGTAC TTGATGCCCT GCTGGCACTG GTCCACATCC TGAGCGATCG 
0061 CCTGCTGGAG TTCGTACTGG ACTGGTATTT GGGCGAGCAC AAGCGG-GTA TCGGGTCCAC 
0121 CGAGCCTGGA ACAGCAGACG ACGATTACGA AGAGCGCTGT GGAGTTGGCG CAACAGATAC 
0181 GGGAACGCAG GCAGCGCAGT TACGACATAG TCAAGGCCTA CTGTGAGCGA ATCGAGAGCG 
0241 TTAATCGGGA TCTCAATGCG GTGGTCGATG GCCCGTTTCC GGAGGCCTTG GACCAGGCAC 
0301 GCGAAATCGA TCGCAAGTTG GACGAAAAGG AGTACAGCGA TGAGGATCTG CGGCGCCTGC 
0361 CCTTCCTAGG CGTACCCTTC TCCACCAAGG ATAGCA-CCG CTGTGGCTGG GAGGCTACAC 
0421 ACACTGGGCC TGCTAGCAAG GAAATCGGAA CGTTCGACCA CGGATGCGGA ATGCGTGCGC 
0481 CTGATGAAGG AAAGTGGCGC CA 
 Assemble Data

5112R-1.IR_full       1   GTCATTTTGGAGCCACGTACTTGATGCCCTGCTGGCACTGGTCCACATCCTGAGCGATCG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5112R-1.in silico     1   GTCATTTTGGAGCCACGTACTTGATGCCCTGCTGGCACTGGTCCACATCCTGAGCGATCG 60


5112R-1.IR_full       61  CCTGCTGGAGTTCGTACTGGACTGGTATTTGGGCGAGCACAAGCGGTGTATCGGGTCCAC 120
                          |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
5112R-1.in silico     61  CCTGCTGGAGTTCGTACTGGACTGGTATTTGGGCGAGCACAAGCGG-GTATCGGGTCCAC 120


5112R-1.IR_full       121 CGAGCCTGGAACAGCAGACGACGATTACGAAGAGCGCTGTGGAGTTGGCGCAACAGATAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5112R-1.in silico     121 CGAGCCTGGAACAGCAGACGACGATTACGAAGAGCGCTGTGGAGTTGGCGCAACAGATAC 180


5112R-1.IR_full       181 GGGAACGCAGGCAGCGCAGTTACGACATAGTCAAGGCCTACTGTGAGCGAATCGAGAGCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5112R-1.in silico     181 GGGAACGCAGGCAGCGCAGTTACGACATAGTCAAGGCCTACTGTGAGCGAATCGAGAGCG 240


5112R-1.IR_full       241 TTAATCGGGATCTCAATGCGGTGGTCGATGGCCCGTTTCCGGAGGCCTTGGACCAGGCAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5112R-1.in silico     241 TTAATCGGGATCTCAATGCGGTGGTCGATGGCCCGTTTCCGGAGGCCTTGGACCAGGCAC 300


5112R-1.IR_full       301 GCGAAATCGATCGCAAGTTGGACGAAAAGGAGTACAGCGATGAGGATCTGCGGCGCCTGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5112R-1.in silico     301 GCGAAATCGATCGCAAGTTGGACGAAAAGGAGTACAGCGATGAGGATCTGCGGCGCCTGC 360


5112R-1.IR_full       361 CCTTCCTAGGCGTACCCTTCTCCACCAAGGATAGCANCCGCTGTGGCTGGGAGGCTACAC 420
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
5112R-1.in silico     361 CCTTCCTAGGCGTACCCTTCTCCACCAAGGATAGCA-CCGCTGTGGCTGGGAGGCTACAC 420


5112R-1.IR_full       421 ACACTGGGCCTGCTAGCAAGGAAATCGGAACGTTCGACCACGGATGCGGAATGCGTGCGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5112R-1.in silico     421 ACACTGGGCCTGCTAGCAAGGAAATCGGAACGTTCGACCACGGATGCGGAATGCGTGCGC 480


5112R-1.IR_full       481 CTGATGAAGGAAAGTGGCGCCA 502
                          ||||||||||||||||||||||
5112R-1.in silico     481 CTGATGAAGGAAAGTGGCGCCA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143143.2  CG5112-RA (CG5112), mRNA 
0   NM_176283.1  CG7447-RB, transcript variant B (CG7447), mRNA 
0   NM_139641.2  CG7447-RA, transcript variant A (CG7447), mRNA 
0   NM_001043216.1  CG34113-RO, transcript variant O (CG34113), mRNA 
0   NM_001043217.1  CG34113-RP, transcript variant P (CG34113), mRNA 
0   NM_139426.2  CG1140-RA, transcript variant A (CG1140), mRNA 
0   NM_167928.1  CG1140-RB, transcript variant B (CG1140), mRNA 
0   NM_078735.4  CG15396-RA, transcript variant A (Gr23a), mRNA 
0   NM_135346.2  CG8460-RA (CG8460), mRNA 
0   NM_168037.1  CG32264-RA, transcript variant A (CG32264), mRNA 
0   NM_168038.1  CG32264-RD, transcript variant D (CG32264), mRNA 
0   NM_168039.1  CG32264-RB, transcript variant B (CG32264), mRNA 
0   NM_206268.1  CG32264-RC, transcript variant C (CG32264), mRNA 
0   NM_079097.1  CG9820-RA (Or59a), mRNA 
0   NM_168834.1  CG6933-RC, transcript variant C (CG6933), mRNA 
0   NM_137203.2  CG8192-RA (CG8192), mRNA 
0   NM_132385.2  CG2967-RA (CG2967), mRNA 
0   NM_142868.1  CG13830-RA (CG13830), mRNA 
0   NM_079298.2  CG7636-RA (mRpL2), mRNA 
0   NM_168833.1  CG6933-RB, transcript variant B (CG6933), mRNA 
0   NM_079214.2  CG5495-RA (Txl), mRNA 
0   NM_079617.3  CG7855-RA (timeout), mRNA 
0   NM_142493.2  CG7717-RA, transcript variant A (Mekk1), mRNA 
0   NM_169833.1  CG7717-RB, transcript variant B (Mekk1), mRNA 
0   NM_135287.1  CG13792-RA (CG13792), mRNA 
0   NM_165306.1  CG10186-RC, transcript variant C (CG10186), mRNA 
0   NM_132962.1  CG8945-RC (CG8945), mRNA 
0   NM_130714.1  CG13317-RA (Ilp7), mRNA 
0   NM_140331.2  CG10627-RA (CG10627), mRNA 
0   NM_165757.1  CG18408-RC, transcript variant C (CAP), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.