National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5085R-5 
 Symbol Sirt2  Full Name Sirt2 
 CG No CG5085  Old CG No CG5085 
 Synonyms CG5085, dSIRT2, D.mel2, Sirt2 
 Accession No (Link to NCBI) NM_142623.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kusama S, Ueda R, Suda T, Nishihara S, Matsuura ET.
Involvement of Drosophila Sir2-like genes in the regulation of life span.
Genes Genet. Syst. (2006) 81(5) 341-8 [ PubMed ID = 17159295 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGCAAGGAGTACGACATGGAC 
 Primer Seq. 3'
aatctagaggtaccTCCTTCTTGTCCCTATCGCCC 
 Predicted Fragment Size
548 
 IR fragment full Seq
0001 CGCAAGGAGT ACGACATGGA CTGGATGAAG GCGGAGATCT TCGCCGATCG TCTGCCCAAA 
0061 TGCCAAAAGT GCCAAGGCGT TGTTAAACCA GACATTGTTT TCTTTGGCGA AAACTTGCCA 
0121 AAGAGATTTT ACTCCAGTCC TGAAGAGGAT TTCCAGGATT GCGATCTGCT GATCATCATG 
0181 GGCACATCGT TGGAAGTGCA ACCGTTTGCT TCACTGGTGT GGAGACCAGG ACCACGTTGC 
0241 ATTCGCCTCT TGATCAATCG CGATGCAGTG GGTCAGGCCA GCTGTGTGCT CTTTATGGAT 
0301 CCCAACACGC GATCGCTACT CTTCGATAAG CCCAATAACA CTAGGGATGT GGCCTTTCTG 
0361 GGCGACTGTG ATGCTGGCGT AATGGCTCTG GcCAAAGCCT TGGGCTGGGA CCAAGAGCTG 
0421 CAGCAGCTAA TTACAAGTGA AAGGAAGAAA CTGAGCGGCA GCCAGAATAG TGAGGAGCTG 
0481 CAACAAGGCA AAGAGAAACC GCAATCGGAC CCGGATAAGA TGACTTCGGG CGATAGGGAC 
0541 AAGAAGGA 
 in silico PCR Fragment
0001 CGCAAGGAGT ACGACATGGA CTGGATGAAG GCGGAGATCT TCGCCGATCG TCTGCCCAAA 
0061 TGCCAAAAGT GCCAAGGCGT TGTTAAACCA GACATTGTTT TCTTTGGCGA AAACTTGCCA 
0121 AAGAGATTTT ACTCCAGTCC TGAAGAGGAT TTCCAGGATT GCGATCTGCT GATCATCATG 
0181 GGCACATCGT TGGAAGTGCA ACCGTTTGCT TCACTGGTGT GGAGACCAGG ACCACGTTGC 
0241 ATTCGCCTCT TGATCAATCG CGATGCAGTG GGTCAGGCCA GCTGTGTGCT CTTTATGGAT 
0301 CCCAACACGC GATCGCTACT CTTCGATAAG CCCAATAACA CTAGGGATGT GGCCTTTCTG 
0361 GGCGACTGTG ATGCTGGCGT AATGGCTCTG GCCAAAGCCT TGGGCTGGGA CCAAGAGCTG 
0421 CAGCAGCTAA TTACAAGTGA AAGGAAGAAA CTGAGCGGCA GCCAGAATAG TGAGGAGCTG 
0481 CAACAAGGCA AAGAGAAACC GCAATCGGAC CCGGATAAGA TGACTTCGGG CGATAGGGAC 
0541 AAGAAGGA 
 Assemble Data

5085R-5.IR_full       1   CGCAAGGAGTACGACATGGACTGGATGAAGGCGGAGATCTTCGCCGATCGTCTGCCCAAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5085R-5.in silico     1   CGCAAGGAGTACGACATGGACTGGATGAAGGCGGAGATCTTCGCCGATCGTCTGCCCAAA 60


5085R-5.IR_full       61  TGCCAAAAGTGCCAAGGCGTTGTTAAACCAGACATTGTTTTCTTTGGCGAAAACTTGCCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5085R-5.in silico     61  TGCCAAAAGTGCCAAGGCGTTGTTAAACCAGACATTGTTTTCTTTGGCGAAAACTTGCCA 120


5085R-5.IR_full       121 AAGAGATTTTACTCCAGTCCTGAAGAGGATTTCCAGGATTGCGATCTGCTGATCATCATG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5085R-5.in silico     121 AAGAGATTTTACTCCAGTCCTGAAGAGGATTTCCAGGATTGCGATCTGCTGATCATCATG 180


5085R-5.IR_full       181 GGCACATCGTTGGAAGTGCAACCGTTTGCTTCACTGGTGTGGAGACCAGGACCACGTTGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5085R-5.in silico     181 GGCACATCGTTGGAAGTGCAACCGTTTGCTTCACTGGTGTGGAGACCAGGACCACGTTGC 240


5085R-5.IR_full       241 ATTCGCCTCTTGATCAATCGCGATGCAGTGGGTCAGGCCAGCTGTGTGCTCTTTATGGAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5085R-5.in silico     241 ATTCGCCTCTTGATCAATCGCGATGCAGTGGGTCAGGCCAGCTGTGTGCTCTTTATGGAT 300


5085R-5.IR_full       301 CCCAACACGCGATCGCTACTCTTCGATAAGCCCAATAACACTAGGGATGTGGCCTTTCTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5085R-5.in silico     301 CCCAACACGCGATCGCTACTCTTCGATAAGCCCAATAACACTAGGGATGTGGCCTTTCTG 360


5085R-5.IR_full       361 GGCGACTGTGATGCTGGCGTAATGGCTCTGGCCAAAGCCTTGGGCTGGGACCAAGAGCTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5085R-5.in silico     361 GGCGACTGTGATGCTGGCGTAATGGCTCTGGCCAAAGCCTTGGGCTGGGACCAAGAGCTG 420


5085R-5.IR_full       421 CAGCAGCTAATTACAAGTGAAAGGAAGAAACTGAGCGGCAGCCAGAATAGTGAGGAGCTG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5085R-5.in silico     421 CAGCAGCTAATTACAAGTGAAAGGAAGAAACTGAGCGGCAGCCAGAATAGTGAGGAGCTG 480


5085R-5.IR_full       481 CAACAAGGCAAAGAGAAACCGCAATCGGACCCGGATAAGATGACTTCGGGCGATAGGGAC 540
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5085R-5.in silico     481 CAACAAGGCAAAGAGAAACCGCAATCGGACCCGGATAAGATGACTTCGGGCGATAGGGAC 540


5085R-5.IR_full       541 AAGAAGGA 548
                          ||||||||
5085R-5.in silico     541 AAGAAGGA 548

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   530  NM_142623.2  CG5085-RA (Sirt2), mRNA 
0.18   NM_168811.1  CG32209-RB (CG32209), mRNA 
0.18   NM_141004.1  CG3680-RA (CG3680), mRNA 
0.18   NM_168091.1  CG32244-RB, transcript variant B (CG32244), mRNA 
0.18   NM_168092.1  CG32244-RC, transcript variant C (CG32244), mRNA 
0   NM_137172.1  CG8090-RA (CG8090), mRNA 
0   NM_057790.4  CG32848-RA (VAChT), mRNA 
0   NM_165418.1  CG2944-RA, transcript variant A (gus), mRNA 
0   NM_165422.1  CG2944-RF, transcript variant F (gus), mRNA 
0   NM_136314.2  CG2944-RB, transcript variant B (gus), mRNA 
0   NM_165419.1  CG2944-RE, transcript variant E (gus), mRNA 
0   NM_165421.1  CG2944-RC, transcript variant C (gus), mRNA 
0   NM_165420.1  CG2944-RD, transcript variant D (gus), mRNA 
0   NM_078828.2  CG14936-RA (Tsp33B), mRNA 
0   NM_139785.1  CG10163-RA (CG10163), mRNA 
0   NM_169450.1  CG14741-RA (CG14741), mRNA 
0   NM_143372.1  CG9995-RA (htt), mRNA 
0   NM_138168.2  CG16940-RA, transcript variant A (CG16940), mRNA 
0   NM_167805.1  CG16940-RC, transcript variant C (CG16940), mRNA 
0   NM_167806.1  CG16940-RB, transcript variant B (CG16940), mRNA 
0   NM_132053.1  CG6041-RA (CG6041), mRNA 
0   NM_079560.3  CG8039-RA (mRpL19), mRNA 
0   NM_078645.2  CG4252-RA (mei-41), mRNA 
0   NM_143316.2  CG5586-RB (Tusp), mRNA 
0   NM_137617.3  CG11209-RA (ppk6), mRNA 
0   NM_135764.3  CG5287-RA (CG5287), mRNA 
0   NM_205943.1  CG33298-RA, transcript variant A (CG33298), mRNA 
0   NM_205944.1  CG33298-RB, transcript variant B (CG33298), mRNA 
0   NM_132896.1  CG9981-RA (CG9981), mRNA 
0   NM_138986.3  CG1168-RA, transcript variant A (7B2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.