National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5085R-3 
 Symbol Sirt2  Full Name Sirt2 
 CG No CG5085  Old CG No CG5085 
 Synonyms CG5085, dSIRT2, D.mel2, Sirt2 
 Accession No (Link to NCBI) NM_142623.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
Kusama S, Ueda R, Suda T, Nishihara S, Matsuura ET.
Involvement of Drosophila Sir2-like genes in the regulation of life span.
Genes Genet. Syst. (2006) 81(5) 341-8 [ PubMed ID = 17159295 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGCAAGGAGTACGACATGGACTGGATGAAGGCGGAGATCTTCGCCGATCGTCTGCCCAAA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TGCCAAAAGTGCCAAGGCGTTGTTAAACCAGACATTGTTTTCTTTGGCGAAAACTTGCCA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AAGAGATTTTACTCCAGTCCTGAAGAGGATTTCCAGGATTGCGATCTGCTGATCATCATG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGCACATCGTTGGAAGTGCAACCGTTTGCTTCACTGGTGTGGAGACCAGGACCACGTTGC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATTCGCCTCTTGATCAATCGCGATGCAGTGGGTCAGGCCAGCTGTGTGCTCTTTATGGAT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCCAACACGCGATCGCTACTCTTCGATAAGCCCAATAACACTAGGGATGTGGCCTTTCTG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGCGACTGTGATGCTGGCGTAATGGCTCTGGCCAAAGCCTTGGGCTGGGACCAAGAGCTG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CAGCAGCTAATTACAAGTGAAAGGAAGAAACTGAGCGGCAGCCAGAATAGTGAGGAGCTG 480

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     481 CAACAAGGCAAAGAGAAACCGCAATCGGACCCGGATAAGATGACTTCGGGCGATAGGGAC 540

5085R-3.IR_full       541 AAGAAGGA 548
                          |||||||| silico     541 AAGAAGGA 548

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   530  NM_142623.2  CG5085-RA (Sirt2), mRNA 
0.18   NM_168811.1  CG32209-RB (CG32209), mRNA 
0.18   NM_141004.1  CG3680-RA (CG3680), mRNA 
0.18   NM_168091.1  CG32244-RB, transcript variant B (CG32244), mRNA 
0.18   NM_168092.1  CG32244-RC, transcript variant C (CG32244), mRNA 
0   NM_137172.1  CG8090-RA (CG8090), mRNA 
0   NM_057790.4  CG32848-RA (VAChT), mRNA 
0   NM_165418.1  CG2944-RA, transcript variant A (gus), mRNA 
0   NM_165422.1  CG2944-RF, transcript variant F (gus), mRNA 
0   NM_136314.2  CG2944-RB, transcript variant B (gus), mRNA 
0   NM_165419.1  CG2944-RE, transcript variant E (gus), mRNA 
0   NM_165421.1  CG2944-RC, transcript variant C (gus), mRNA 
0   NM_165420.1  CG2944-RD, transcript variant D (gus), mRNA 
0   NM_078828.2  CG14936-RA (Tsp33B), mRNA 
0   NM_139785.1  CG10163-RA (CG10163), mRNA 
0   NM_169450.1  CG14741-RA (CG14741), mRNA 
0   NM_143372.1  CG9995-RA (htt), mRNA 
0   NM_138168.2  CG16940-RA, transcript variant A (CG16940), mRNA 
0   NM_167805.1  CG16940-RC, transcript variant C (CG16940), mRNA 
0   NM_167806.1  CG16940-RB, transcript variant B (CG16940), mRNA 
0   NM_132053.1  CG6041-RA (CG6041), mRNA 
0   NM_079560.3  CG8039-RA (mRpL19), mRNA 
0   NM_078645.2  CG4252-RA (mei-41), mRNA 
0   NM_143316.2  CG5586-RB (Tusp), mRNA 
0   NM_137617.3  CG11209-RA (ppk6), mRNA 
0   NM_135764.3  CG5287-RA (CG5287), mRNA 
0   NM_205943.1  CG33298-RA, transcript variant A (CG33298), mRNA 
0   NM_205944.1  CG33298-RB, transcript variant B (CG33298), mRNA 
0   NM_132896.1  CG9981-RA (CG9981), mRNA 
0   NM_138986.3  CG1168-RA, transcript variant A (7B2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.