National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5059R-1 
 Symbol CG5059  Full Name CG5059 
 CG No CG5059  Old CG No CG5059 
 Synonyms CG5059 
 Accession No (Link to NCBI) NM_140982.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tang HW, Spirohn K, Hu Y, Hao T, Kovács IA, Gao Y, Binari R, Yang-Zhou D, Wan KH, Bader JS, Balcha D, Bian W, Booth BW, Coté AG, de Rouck S, Desbuleux A, Goh KY, Kim DK, Knapp JJ, Lee WX, Lemmens I, Li C, Li M, Li R, Lim HJ, Liu Y, Luck K, Markey D, Pollis C, Rangarajan S, Rodiger J, Schlabach S, Shen Y, Sheykhkarimli D, TeeKing B, Roth FP, Tavernier J, Calderwood MA, Hill DE, Celniker SE, Vidal M, Perrimon N, Mohr SE.
Next-generation large-scale binary protein interaction network for Drosophila melanogaster.
Nat Commun (2023) 14(1) 2162 [ PubMed ID = 37061542 ] [ RRC reference ]

Ham SJ, Lee D, Xu WJ, Cho E, Choi S, Min S, Park S, Chung J.
Loss of UCHL1 rescues the defects related to Parkinson's disease by suppressing glycolysis.
Sci Adv (2021) 7(28) [ PubMed ID = 34244144 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTCTACGACACCAAAATCGAG 
 Primer Seq. 3'
aatctagaggtaccACAGAATTTCGCGGGAGAACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTCTACGACA CCAAAATCGA GCGAAGATTT GCTGGGCGAA TCTTGGATCG AACTCAGCAC 
0061 AACAGCTGCG ATGGCTGGCA TCAAGAGCCC CGACAGAAAT CACTCCGTTG CCATTCAACA 
0121 ATGGCGAGGA GTACCTGAGA CTTTCTGCGC GAGGCCCAGC GCGAGTCGAA CCAGTCGAGC 
0181 CGTGTCGTCT CCTTGGCCAG CTCCCGTCGT GATACGCCCC GTGATAGCCC CAAGAGTCCA 
0241 CCGAACAGTC CCCAGTCGGA GCTCTGTCCG GATGATGAGC TCAGAAACGT GTACATCAAC 
0301 TACTGGACCA AGGGAGGAGA CAAACAGAAT GCAGGCAATG AAGATTGGCT GAAGAACTGG 
0361 AATCAGCCAC CCAGTAGCTG GAACATTGAG GATTCAAGTC GGGATGCCGG CGACGAGGGC 
0421 GAGAAAAAGA AGACTAACAC AGGCTACTCC ATCCGTTTGA AGCGACTGGG CTCCAACTCG 
0481 TTGTTCTCCC GCGAAATTCT GT 
 in silico PCR Fragment
0001 GTCTACGACA CCAAAATCGA GCGAAGATTT GCTGGGCGAA TCTTGGATCG AACTCAGCAC 
0061 AACAGCTGCG ATGGCTGGCA TCAAGAGCCC CGACAG-AAT CACTCCGTTG CCATTCAACA 
0121 ATGGCGAGGA GTACCTGAGA C-TTCTGCGC GAGGCCCAGC GCGAGTCGAA CCAGTCGAGC 
0181 CGTGTCGTCT CCTTGGCCAG CTCCCGTCGT GATACGCCCC GTGATAGCCC CAAGAGTCCA 
0241 CCGAACAGTC CCCAGTCGGA GCTCTGTCCG GATGATGAGC TCAGAAACGT GTACATCAAC 
0301 TACTGGACCA AGGGAGGAGA CAAACAGAAT GCAGGCAATG AAGATTGGCT GAAGAACTGG 
0361 AATCAGCCAC CCAGTAGCTG GAACATTGAG GATTCAAGTC GGGATGCCGG CGACGAGGGC 
0421 GAGAAAAAGA AGACTAACAC AGGCTACTCC ATCCGTTTGA AGCGACTGGG CTCCAACTCG 
0481 TTGTTCTCCC GCGAAATTCT GT 
 Assemble Data

5059R-1.IR_full       1   GTCTACGACACCAAAATCGAGCGAAGATTTGCTGGGCGAATCTTGGATCGAACTCAGCAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5059R-1.in silico     1   GTCTACGACACCAAAATCGAGCGAAGATTTGCTGGGCGAATCTTGGATCGAACTCAGCAC 60


5059R-1.IR_full       61  AACAGCTGCGATGGCTGGCATCAAGAGCCCCGACAGAAATCACTCCGTTGCCATTCAACA 120
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
5059R-1.in silico     61  AACAGCTGCGATGGCTGGCATCAAGAGCCCCGACAG-AATCACTCCGTTGCCATTCAACA 120


5059R-1.IR_full       121 ATGGCGAGGAGTACCTGAGACTTTCTGCGCGAGGCCCAGCGCGAGTCGAACCAGTCGAGC 180
                          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
5059R-1.in silico     121 ATGGCGAGGAGTACCTGAGAC-TTCTGCGCGAGGCCCAGCGCGAGTCGAACCAGTCGAGC 180


5059R-1.IR_full       181 CGTGTCGTCTCCTTGGCCAGCTCCCGTCGTGATACGCCCCGTGATAGCCCCAAGAGTCCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5059R-1.in silico     181 CGTGTCGTCTCCTTGGCCAGCTCCCGTCGTGATACGCCCCGTGATAGCCCCAAGAGTCCA 240


5059R-1.IR_full       241 CCGAACAGTCCCCAGTCGGAGCTCTGTCCGGATGATGAGCTCAGAAACGTGTACATCAAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5059R-1.in silico     241 CCGAACAGTCCCCAGTCGGAGCTCTGTCCGGATGATGAGCTCAGAAACGTGTACATCAAC 300


5059R-1.IR_full       301 TACTGGACCAAGGGAGGAGACAAACAGAATGCAGGCAATGAAGATTGGCTGAAGAACTGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5059R-1.in silico     301 TACTGGACCAAGGGAGGAGACAAACAGAATGCAGGCAATGAAGATTGGCTGAAGAACTGG 360


5059R-1.IR_full       361 AATCAGCCACCCAGTAGCTGGAACATTGAGGATTCAAGTCGGGATGCCGGCGACGAGGGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5059R-1.in silico     361 AATCAGCCACCCAGTAGCTGGAACATTGAGGATTCAAGTCGGGATGCCGGCGACGAGGGC 420


5059R-1.IR_full       421 GAGAAAAAGAAGACTAACACAGGCTACTCCATCCGTTTGAAGCGACTGGGCTCCAACTCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5059R-1.in silico     421 GAGAAAAAGAAGACTAACACAGGCTACTCCATCCGTTTGAAGCGACTGGGCTCCAACTCG 480


5059R-1.IR_full       481 TTGTTCTCCCGCGAAATTCTGT 502
                          ||||||||||||||||||||||
5059R-1.in silico     481 TTGTTCTCCCGCGAAATTCTGT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140982.1  CG5059-RA, transcript variant A (CG5059), mRNA 
92.11   444  NM_168865.1  CG5059-RC, transcript variant C (CG5059), mRNA 
92.11   444  NM_206403.1  CG5059-RD, transcript variant D (CG5059), mRNA 
92.11   444  NM_168864.1  CG5059-RB, transcript variant B (CG5059), mRNA 
0   NM_130494.2  CG13369-RA (CG13369), mRNA 
0   NM_132909.1  CG9782-RA (CG9782), mRNA 
0   NM_132364.2  CG1889-RA, transcript variant A (CG1889), mRNA 
0   NM_167208.1  CG1889-RB, transcript variant B (CG1889), mRNA 
0   NM_170546.1  CG31005-RA (CG31005), mRNA 
0   NM_001043280.1  CG34149-RA (CG34149), mRNA 
0   NM_143436.1  CG2006-RA (CG2006), mRNA 
0   NM_176583.1  CG11500-RA (Spase12), mRNA 
0   NM_206542.1  CG7073-RE, transcript variant E (sar1), mRNA 
0   NM_170000.2  CG7073-RA, transcript variant A (sar1), mRNA 
0   NM_170002.2  CG7073-RD, transcript variant D (sar1), mRNA 
0   NM_170001.2  CG7073-RC, transcript variant C (sar1), mRNA 
0   NM_142768.3  CG7073-RB, transcript variant B (sar1), mRNA 
0   15  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   12  NM_079937.2  CG1915-RA, transcript variant A (sls), mRNA 
0   NM_136477.2  CG30497-RA, transcript variant A (CG30497), mRNA 
0   NM_001014604.1  CG9795-RD, transcript variant D (CG9795), mRNA 
0   NM_141197.3  CG9795-RA, transcript variant A (CG9795), mRNA 
0   NM_176396.1  CG9795-RC, transcript variant C (CG9795), mRNA 
0   NM_164338.2  CG9795-RB, transcript variant B (CG9795), mRNA 
0   NM_143160.1  CG4759-RA (RpL27), mRNA 
0   NM_132201.1  CG15332-RA, transcript variant A (CG15332), mRNA 
0   NM_206644.1  CG15332-RB, transcript variant B (CG15332), mRNA 
0   NM_134722.1  CG14339-RA (CG14339), mRNA 
0   NM_132182.1  CG15326-RA (CG15326), mRNA 
0   NM_206335.1  CG7334-RB, transcript variant B (Sug), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.