National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5057R-1 
 Symbol MED10  Full Name Mediator complex subunit 10 
 CG No CG5057  Old CG No CG5057 
 Synonyms Med10, Nut2, CG5057, dTRAP15, dMED10, BcDNA:SD24044, MED10 
 Accession No (Link to NCBI) NM_140592.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Terriente-Félix A, López-Varea A, de Celis JF.
Identification of genes affecting wing patterning through a loss-of-function mutagenesis screen and characterization of med15 function during wing development.
Genetics (2010) 185(2) 671-84 [ PubMed ID = 20233856 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTCTGCACCGCTAGAGAAC 
 Primer Seq. 3'
aatctagaggtaccCCTTGCGATAAGCGCGGTAGT 
 Predicted Fragment Size
385 
 IR fragment full Seq
0001 ATGTCTGCAC CGCTAGAGAA CCTTGAGACC CAGCTAGAGA TGTTCATCGA GAATGTTCGT 
0061 CAGATCCGCA TAATCGTAAG CGATTTTCAG CCACAGGGTC AAAATGTACT CAACCAGAAA 
0121 ATTRACAGCT TGGTGACCGG CCTACAAGAG ATCGACAAGC TGCGCTCCCA GGTGCAGGAC 
0181 GTCTATGTGC CATTTGAAGT GTTTTTTGAC TACATCGACC AAGACAAGAA TCCTCAGCTG 
0241 TACACCAAGG ATTGCGTGGA GAAGGCACTG GCCAAGAACG AGGAGGTCAA GGGCAAGATC 
0301 GAGGGCCTGA AGAAGTTCAA AACGAATCTG CTGCTGGAGC TGTATAAAAC ATTTCCCAAT 
0361 GAGATGAACA ACTACCGCGC TTATCGCAAG G 
 in silico PCR Fragment
0001 ATGTCTGCAC CGCTAGAGAA CCTTGAGACC CAGCTAGAGA TGTTCATCGA GAATGTTCGT 
0061 CAGATCCGCA TAATCGTAAG CGATTTTCAG CCACAGGGTC AAAATGTACT CAACCAGAAA 
0121 AT------CT TGGTGACCGG CCTACAAGAG ATCGACAAGC TGCGCTCCCA GGTGCAGGAC 
0181 GTCTATGTGC CATTTGAAGT GTTTTTTGAC TACATCGACC AAGACAAGAA TCCTCAGCTG 
0241 TACACCAAGG ATTGCGTGGA GAAGGCACTG GCCAAGAACG AGGAGGTCAA GGGCAAGATC 
0301 GAGGGCCTGA AGAAGTTCAA AACGAATCTG CTGCTGGAGC TGTATAAAAC ATTTCCCAAT 
0361 GAGATGAACA ACTACCGCGC TTATCGCAAG G 
 Assemble Data

5057R-1.IR_full       1   ATGTCTGCACCGCTAGAGAACCTTGAGACCCAGCTAGAGATGTTCATCGAGAATGTTCGT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5057R-1.in silico     1   ATGTCTGCACCGCTAGAGAACCTTGAGACCCAGCTAGAGATGTTCATCGAGAATGTTCGT 60


5057R-1.IR_full       61  CAGATCCGCATAATCGTAAGCGATTTTCAGCCACAGGGTCAAAATGTACTCAACCAGAAA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5057R-1.in silico     61  CAGATCCGCATAATCGTAAGCGATTTTCAGCCACAGGGTCAAAATGTACTCAACCAGAAA 120


5057R-1.IR_full       121 ATTRACAGCTTGGTGACCGGCCTACAAGAGATCGACAAGCTGCGCTCCCAGGTGCAGGAC 180
                          ||      ||||||||||||||||||||||||||||||||||||||||||||||||||||
5057R-1.in silico     121 AT------CTTGGTGACCGGCCTACAAGAGATCGACAAGCTGCGCTCCCAGGTGCAGGAC 180


5057R-1.IR_full       181 GTCTATGTGCCATTTGAAGTGTTTTTTGACTACATCGACCAAGACAAGAATCCTCAGCTG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5057R-1.in silico     181 GTCTATGTGCCATTTGAAGTGTTTTTTGACTACATCGACCAAGACAAGAATCCTCAGCTG 240


5057R-1.IR_full       241 TACACCAAGGATTGCGTGGAGAAGGCACTGGCCAAGAACGAGGAGGTCAAGGGCAAGATC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5057R-1.in silico     241 TACACCAAGGATTGCGTGGAGAAGGCACTGGCCAAGAACGAGGAGGTCAAGGGCAAGATC 300


5057R-1.IR_full       301 GAGGGCCTGAAGAAGTTCAAAACGAATCTGCTGCTGGAGCTGTATAAAACATTTCCCAAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5057R-1.in silico     301 GAGGGCCTGAAGAAGTTCAAAACGAATCTGCTGCTGGAGCTGTATAAAACATTTCCCAAT 360


5057R-1.IR_full       361 GAGATGAACAACTACCGCGCTTATCGCAAGG 391
                          |||||||||||||||||||||||||||||||
5057R-1.in silico     361 GAGATGAACAACTACCGCGCTTATCGCAAGG 391

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   367  NM_140592.2  CG5057-RA (MED10), mRNA 
0   NM_136935.1  CG8834-RA (CG8834), mRNA 
0   NM_142939.1  CG5854-RA, transcript variant A (CG5854), mRNA 
0   NM_170099.1  CG5854-RB, transcript variant B (CG5854), mRNA 
0   NM_142427.2  CG7940-RA (CG7940), mRNA 
0   NM_132688.2  CG11134-RA (CG11134), mRNA 
0   NM_058090.2  CG7121-RA (Tehao), mRNA 
0   NM_001043166.1  CG40298-RA (CG40298), mRNA 
0   NM_001014630.1  CG33547-RA (Rim), mRNA 
0   NM_080169.2  CG2723-RA (ImpE3), mRNA 
0   NM_140582.2  CG5215-RA, transcript variant A (Zn72D), mRNA 
0   NM_176332.1  CG5215-RB, transcript variant B (Zn72D), mRNA 
0   NM_132100.3  CG10695-RA (Pat1), mRNA 
0   NM_137828.1  CG10972-RA (ppk12), mRNA 
0   NM_206633.1  CG3842-RB, transcript variant B (CG3842), mRNA 
0   NM_132088.1  CG3842-RA, transcript variant A (CG3842), mRNA 
0   NM_167488.1  CG13956-RA, transcript variant A (kat80), mRNA 
0   NM_078639.2  CG13956-RB, transcript variant B (kat80), mRNA 
0   NM_141760.2  CG6554-RA (Art1), mRNA 
0   NM_138118.2  CG3880-RA (CG3880), mRNA 
0   NM_136619.2  CG30342-RA (CG30342), mRNA 
0   NM_079866.2  CG1744-RA (chp), mRNA 
0   NM_141538.1  CG7352-RA (CG7352), mRNA 
0   NM_001038966.1  CG33967-RA (CG33967), mRNA 
0   NM_166876.1  CG14622-RB, transcript variant B (DAAM), mRNA 
0   NM_166875.1  CG14622-RC, transcript variant C (DAAM), mRNA 
0   NM_130544.3  CG14622-RA, transcript variant A (DAAM), mRNA 
0   NM_058067.2  CG6147-RA (Tsc1), mRNA 
0   NM_079640.2  CG6226-RA (FK506-bp1), mRNA 
0   NM_142787.1  CG12499-RA (CG12499), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.