National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5055R-2 
 Symbol baz  Full Name bazooka 
 CG No CG5055  Old CG No CG5055 
 Synonyms baz, Par-3, Baz, par-3, PAR3, Par3, dPar-3, l(1)G0484, D-Par3, CG5055, Baz/Par-3, PAR-3 
 Accession No (Link to NCBI) NM_078659.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Jones TA, Metzstein MM.
A novel function for the PAR complex in subcellular morphogenesis of tracheal terminal cells in Drosophila melanogaster.
Genetics (2011) 189(1) 153-64 [ PubMed ID = 21750259 ] [ RRC reference ]

Banerjee JJ, Aerne BL, Holder MV, Hauri S, Gstaiger M, Tapon N.
Meru couples planar cell polarity with apical-basal polarity during asymmetric cell division.
Elife (2017) 6 [ PubMed ID = 28665270 ] [ RRC reference ]

Wang H, Qiu Z, Xu Z, Chen SJ, Luo J, Wang X, Chen J.
aPKC is a key polarity determinant in coordinating the function of three distinct cell polarities during collective migration.
Development (2018) 145(9) [ PubMed ID = 29636381 ] [ RRC reference ]

Wang Y, Antunes M, Anderson AE, Kadrmas JL, Jacinto A, Galko MJ.
Integrin Adhesions Suppress Syncytium Formation in the Drosophila Larval Epidermis.
Curr. Biol. (2015) 25(17) 2215-27 [ PubMed ID = 26255846 ] [ RRC reference ]

Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment balanced with SM6a, Cy 
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGAAGGTCACCGTCTGCTTCG 
 Primer Seq. 3'
aatctagaggtaccGCGTTTGTTACTGCCCTCTGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGAAGGTCAC CGTCTGCTTC GGCGACGTTC GCATTCTGGT TCCCTGTGGT TCCGGCGAAC 
0061 TCCTCGTCCG CGATCTCGTC AAGGAGGCCA CGCGACGCTA CATCAAAGGC GGCCGGCAAG 
0121 CCCCGATTCC TGGGTGACCG TGACGCATCT CCAGACACAG TCGGGCATCC TCGATCCGGA 
0181 TGATTGTGTC CGCGACGTGG CCGACGATCG GGAGCAGATA TTGGCGCACT TTGATGACCC 
0241 AGGACCCGAT CCAGGAGTTC CGCAAGGAGG CGGAGATGGA GCATCGGGCA GTTCGTCCGT 
0301 TGGCACCGGT TCGCCGGACA TCTTTCGCGA TCCCACCAAC ACGGAGGCGC CCACCTGTCC 
0361 GCGGGATCTC TCCACGCCAC ACATCGAGGT CACCAGCACC ACATCGGGAC CGATGGCTGG 
0421 ACTCGGAGTT GGACTGATGG TGCGTCGCAG CAGTGATCCC AATCTGCTGG CCTCGCTGAA 
0481 GGCAGAGGGC AGTAACAAAC GC 
 in silico PCR Fragment
0001 TGAAGGTCAC CGTCTGCTTC GGCGACGTTC GCATTCTGGT TCCCTGTGGT TCCGGCGAAC 
0061 TCCTCGTCCG CGATCTCGTC AAGGAGGCCA CGCGACGCTA CATC-AAGGC GGCCGGCAAG 
0121 -CCCGATTCC TGGGTGACCG TGACGCATCT CCAGACACAG TCGGGCATCC TCGATCCGGA 
0181 TGATTGTGTC CGCGACGTGG CCGACGATCG GGAGCAGATA TTGGCGCACT TTGATGACCC 
0241 AGGACCCGAT CCAGGAGTTC CGCAAGGAGG CGGAGATGGA GCATCGGGCA GTTCGTCCGT 
0301 TGGCACCGGT TCGCCGGACA TCTTTCGCGA TCCCACCAAC ACGGAGGCGC CCACCTGTCC 
0361 GCGGGATCTC TCCACGCCAC ACATCGAGGT CACCAGCACC ACATCGGGAC CGATGGCTGG 
0421 ACTCGGAGTT GGACTGATGG TGCGTCGCAG CAGTGATCCC AATCTGCTGG CCTCGCTGAA 
0481 GGCAGAGGGC AGTAACAAAC GC 
 Assemble Data

11897R-3.IR_full       1   CTGACGGACGAGGAGCTGTATCAACATAGAAAGACCCTGGATAGTGAAAGAGTGACGAAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11897R-3.in silico     1   CTGACGGACGAGGAGCTGTATCAACATAGAAAGACCCTGGATAGTGAAAGAGTGACGAAC 60


11897R-3.IR_full       61  AAATTTGCGGAACTGTGGGAGGATGAGCTAAAACGAAGTAATCCCAGTGTGGTGAGGATG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11897R-3.in silico     61  AAATTTGCGGAACTGTGGGAGGATGAGCTAAAACGAAGTAATCCCAGTGTGGTGAGGATG 120


11897R-3.IR_full       121 ATCCTTCGAGCATATGGCAAGATTTTCGTGCCCATGGGGCTGGCGTTCTCCATAAGCGAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11897R-3.in silico     121 ATCCTTCGAGCATATGGCAAGATTTTCGTGCCCATGGGGCTGGCGTTCTCCATAAGCGAA 180


11897R-3.IR_full       181 ACGATTTGCAAATCTCTCATGCCGCTATTCCTGGGCGGTCTGGTCGGTTACTTTGCCACA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11897R-3.in silico     181 ACGATTTGCAAATCTCTCATGCCGCTATTCCTGGGCGGTCTGGTCGGTTACTTTGCCACA 240


11897R-3.IR_full       241 AATCAGACGGATATCAGTGAAAAGACAGCATATTTGTATGCCATGGGAATTGTGATTTGC 300
                           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
11897R-3.in silico     241 AATCAGACGGATATCAGTGAAAACACAGCATATTTGTATGCCATGGGAATTGTGATTTGC 300


11897R-3.IR_full       301 ATGCTGGTGCCTGTGATAACGTTCCATCCTTTCATCTTCTACATCTTTCAAGTGGGCACC 360
                           |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||
11897R-3.in silico     301 ATGCTGGTGCCTGTGATAACGTTCCACCCTTTCATCTTCTACATATTTCAAGTGGGCACC 360


11897R-3.IR_full       361 AAGCTGCGGCTGGCCCTTTCGGGTCTCATCTACCGCAAGGTCCTGCAGGTCTCGAAGAGC 420
                           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
11897R-3.in silico     361 AAGCTGCGGTTGGCCCTTTCGGGTCTCATCTACCGCAAGGTCCTGCAGGTCTCGAAGAGC 420


11897R-3.IR_full       421 AGCAGTAACGATGGTCTGCGAGGAAGAGCAATCAATATTTTGTCCAACGACCTTGGGCGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11897R-3.in silico     421 AGCAGTAACGATGGTCTGCGAGGAAGAGCAATCAATATTTTGTCCAACGACCTTGGGCGC 480


11897R-3.IR_full       481 TTCGACGTGGCGCTGTGTTT 500
                           ||||||||||||||||||||
11897R-3.in silico     481 TTCGACGTGGCGCTGTGTTT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.