National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5055R-2 
 Symbol baz  Full Name bazooka 
 CG No CG5055  Old CG No CG5055 
 Synonyms baz, Par-3, Baz, par-3, PAR3, Par3, dPar-3, l(1)G0484, D-Par3, CG5055, Baz/Par-3, PAR-3 
 Accession No (Link to NCBI) NM_078659.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Banerjee JJ, Aerne BL, Holder MV, Hauri S, Gstaiger M, Tapon N.
Meru couples planar cell polarity with apical-basal polarity during asymmetric cell division.
Elife (2017) 6 [ PubMed ID = 28665270 ] [ RRC reference ]

Wang H, Qiu Z, Xu Z, Chen SJ, Luo J, Wang X, Chen J.
aPKC is a key polarity determinant in coordinating the function of three distinct cell polarities during collective migration.
Development (2018) 145(9) [ PubMed ID = 29636381 ] [ RRC reference ]

Jones TA, Metzstein MM.
A novel function for the PAR complex in subcellular morphogenesis of tracheal terminal cells in Drosophila melanogaster.
Genetics (2011) 189(1) 153-64 [ PubMed ID = 21750259 ] [ RRC reference ]

Wang Y, Antunes M, Anderson AE, Kadrmas JL, Jacinto A, Galko MJ.
Integrin Adhesions Suppress Syncytium Formation in the Drosophila Larval Epidermis.
Curr Biol (2015) 25(17) 2215-27 [ PubMed ID = 26255846 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]  
 Comment balanced with SM6a, Cy 
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CTGACGGACGAGGAGCTGTATCAACATAGAAAGACCCTGGATAGTGAAAGAGTGACGAAC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AAATTTGCGGAACTGTGGGAGGATGAGCTAAAACGAAGTAATCCCAGTGTGGTGAGGATG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ATCCTTCGAGCATATGGCAAGATTTTCGTGCCCATGGGGCTGGCGTTCTCCATAAGCGAA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ACGATTTGCAAATCTCTCATGCCGCTATTCCTGGGCGGTCTGGTCGGTTACTTTGCCACA 240

                           ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| silico     241 AATCAGACGGATATCAGTGAAAACACAGCATATTTGTATGCCATGGGAATTGTGATTTGC 300

                           |||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| silico     301 ATGCTGGTGCCTGTGATAACGTTCCACCCTTTCATCTTCTACATATTTCAAGTGGGCACC 360

                           ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AAGCTGCGGTTGGCCCTTTCGGGTCTCATCTACCGCAAGGTCCTGCAGGTCTCGAAGAGC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGCAGTAACGATGGTCTGCGAGGAAGAGCAATCAATATTTTGTCCAACGACCTTGGGCGC 480

11897R-3.IR_full       481 TTCGACGTGGCGCTGTGTTT 500
                           |||||||||||||||||||| silico     481 TTCGACGTGGCGCTGTGTTT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.