National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5034R-1 
 Symbol GATAd  Full Name GATAd 
 CG No CG5034  Old CG No CG5034 
 Synonyms dGATAd, dGATA-D, CG5034, GATAd 
 Accession No (Link to NCBI) NM_135539.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Buchon N, Osman D, David FP, Fang HY, Boquete JP, Deplancke B, Lemaitre B.
Morphological and molecular characterization of adult midgut compartmentalization in Drosophila.
Cell Rep (2013) 3(5) 1725-38 [ PubMed ID = 23643535 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGTTAACGAGTGCGATGTTG 
 Primer Seq. 3'
aatctagaggtaccTGTTTGGGATTGGGATAGCGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGTTAACGA GTGCGATGTT GCAGTACTAC AGATTTACGA TAATTCGTCG CATAATAATA 
0061 GTGCCCCAGA CAGAATATCG GCCGATTTTC GTGGCGTCNC GAATCGTGCC AACTGCTTTT 
0121 GCAGCGCTTT AAGCCCCAAT CCGTGCAGTT GCATCGTTGA TAACCCGCTA TCAGCCAACA 
0181 AAAATGAACG GCGCAACCAG GGAACACCCG TACCCGTGCC CATACCCATA CCCGTTTCCG 
0241 TGCCTGTGCC CGTTCCAAGC CAGCAGATCC AATCGCAAAC CCTTCACCAT CACCAAAACC 
0301 AAACNTAAAA TCCATTACAC GCCAAGTGTG CCTTCTGCTG CGGACGCAAA GTCGAGTGAG 
0361 CGCGAACGCC AATGCCAATT GGAGTCGGAC ATCGCCGAGA GATCAACAGT ATTCAAAAGT 
0421 CAGTCATCGT CGGGATCACG AACANATAGA ATATAGCGGG GAGACGCCAT CCCCCTCCgN 
0481 ATCGCTATCC CAATCCCAAA CA 
 in silico PCR Fragment
0001 TGGTTAACGA GTGCGATGTT GCAGTACTAC AGATTTACGA TAATTCGTCG CATAATAATA 
0061 GTGCCCCAGA CAGAATATCG GCCGATTTTC GTGGCGTCGC GAATCGTGCC AACTGCTTTT 
0121 GCAGCGCTTT AAGCCCCAAT CCGTGCAGTT GCATCGTTGA TAACCCGCTA TCAGCCAACA 
0181 AAAATGAACG GCGCAACCAG GGAACACCCG TACCCGTGCC CATACCCATA CCCGTTTCCG 
0241 TGCCTGTGCC CGTTCCAAGC CAGCAGATCC AATCGCAAAC CCTTCACCAT CACCAAAACC 
0301 AAAC-TAAAA TCCATTACAC GCCAAGTGTG CCTTCTGCTG CGGACGCAAA GTCGAGTGAG 
0361 CGCGAACGCC AATGCCAATT GGAGTCGGAC ATCGCCGAGA GATCAACAGT ATTCAAAAGT 
0421 CAGTCATCGT C-GGATCACG AACATATAGA ATATAGCGGG GAGACGCCAT CCCCCTCCGC 
0481 ATCGCTATCC CAATCCCAAA CA 
 Assemble Data

5034R-1.IR_full       1   TGGTTAACGAGTGCGATGTTGCAGTACTACAGATTTACGATAATTCGTCGCATAATAATA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5034R-1.in silico     1   TGGTTAACGAGTGCGATGTTGCAGTACTACAGATTTACGATAATTCGTCGCATAATAATA 60


5034R-1.IR_full       61  GTGCCCCAGACAGAATATCGGCCGATTTTCGTGGCGTCNCGAATCGTGCCAACTGCTTTT 120
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
5034R-1.in silico     61  GTGCCCCAGACAGAATATCGGCCGATTTTCGTGGCGTCGCGAATCGTGCCAACTGCTTTT 120


5034R-1.IR_full       121 GCAGCGCTTTAAGCCCCAATCCGTGCAGTTGCATCGTTGATAACCCGCTATCAGCCAACA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5034R-1.in silico     121 GCAGCGCTTTAAGCCCCAATCCGTGCAGTTGCATCGTTGATAACCCGCTATCAGCCAACA 180


5034R-1.IR_full       181 AAAATGAACGGCGCAACCAGGGAACACCCGTACCCGTGCCCATACCCATACCCGTTTCCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5034R-1.in silico     181 AAAATGAACGGCGCAACCAGGGAACACCCGTACCCGTGCCCATACCCATACCCGTTTCCG 240


5034R-1.IR_full       241 TGCCTGTGCCCGTTCCAAGCCAGCAGATCCAATCGCAAACCCTTCACCATCACCAAAACC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5034R-1.in silico     241 TGCCTGTGCCCGTTCCAAGCCAGCAGATCCAATCGCAAACCCTTCACCATCACCAAAACC 300


5034R-1.IR_full       301 AAACNTAAAATCCATTACACGCCAAGTGTGCCTTCTGCTGCGGACGCAAAGTCGAGTGAG 360
                          |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
5034R-1.in silico     301 AAAC-TAAAATCCATTACACGCCAAGTGTGCCTTCTGCTGCGGACGCAAAGTCGAGTGAG 360


5034R-1.IR_full       361 CGCGAACGCCAATGCCAATTGGAGTCGGACATCGCCGAGAGATCAACAGTATTCAAAAGT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5034R-1.in silico     361 CGCGAACGCCAATGCCAATTGGAGTCGGACATCGCCGAGAGATCAACAGTATTCAAAAGT 420


5034R-1.IR_full       421 CAGTCATCGTCGGGATCACGAACANATAGAATATAGCGGGGAGACGCCATCCCCCTCCGN 480
                          ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| 
5034R-1.in silico     421 CAGTCATCGTC-GGATCACGAACATATAGAATATAGCGGGGAGACGCCATCCCCCTCCGC 480


5034R-1.IR_full       481 ATCGCTATCCCAATCCCAAACA 502
                          ||||||||||||||||||||||
5034R-1.in silico     481 ATCGCTATCCCAATCCCAAACA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  NM_135539.2  CG5034-RA (GATAd), mRNA 
0.41   14  NM_136859.2  CG8991-RA (Sobp), mRNA 
0   12  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
0   12  NM_080105.2  CG31243-RF, transcript variant F (cpo), mRNA 
0   12  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
0   12  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
0   11  NM_001014632.1  CG31243-RG, transcript variant G (cpo), mRNA 
0   11  NM_001014631.1  CG31243-RH, transcript variant H (cpo), mRNA 
0   14  26  NM_169851.1  CG31475-RA (CG31475), mRNA 
0   NM_078493.2  CG4206-RA (Mcm3), mRNA 
0   NM_140917.1  CG14186-RA (CG14186), mRNA 
0   NM_078960.4  CG2204-RA, transcript variant A (G-oalpha47A), mRNA 
0   NM_206079.1  CG2204-RI, transcript variant I (G-oalpha47A), mRNA 
0   NM_134843.2  CG3515-RA (CG3515), mRNA 
0   NM_132683.1  CG12177-RA (CG12177), mRNA 
0   NM_164509.2  CG2991-RA, transcript variant A (CG2991), mRNA 
0   NM_134881.5  CG2991-RB, transcript variant B (CG2991), mRNA 
0   NM_057790.4  CG32848-RA (VAChT), mRNA 
0   NM_168324.2  CG4432-RA, transcript variant A (PGRP-LC), mRNA 
0   NM_001015396.1  CG40411-PC.3 (CG40411), mRNA 
0   NM_001015395.1  CG40411-PE.3 (CG40411), mRNA 
0   NM_001015397.1  CG40411-PD.3 (CG40411), mRNA 
0   NM_141593.2  CG11968-RA (CG11968), mRNA 
0   NM_164510.2  CG2991-RC, transcript variant C (CG2991), mRNA 
0   NM_139460.1  CG9004-RA (CG9004), mRNA 
0   NM_079152.3  CG1007-RA (emc), mRNA 
0   15  13  NM_164887.1  CG31714-RA (CG31714), mRNA 
0   NM_132420.2  CG32676-RA (CG32676), mRNA 
0   36  NM_140298.2  CG6906-RA (CAH2), mRNA 
0   NM_166075.1  CG30475-RA (CG30475), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.