National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5032R-1 
 Symbol aft  Full Name adrift 
 CG No CG5032  Old CG No CG5032 
 Synonyms EG:52C10.7, CG5032, aft 
 Accession No (Link to NCBI) NM_058065.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCTTTCGTTCGTCTCCGCAG 
 Primer Seq. 3'
aatctagaggtaccGAGCGCCAGCGCCATTTAATC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCTTTCGTT CGTCTCCGCA GGGAAAGCCA CACCCAATGA CGGACTATCA GTCCATCCGG 
0061 CCTTCCGAAG TGGAGCAGCT CTTCGAGAAG AAGTTCCACT ATCAGAAGCC GAAAGGAAAC 
0121 AAATCCTGGC AGTTGCCGCC ACCGGATCAG GCTCTCTTCA GTGAGTTCTA CCAGTTCGAG 
0181 GCGCTGCAGG GGACTGCGCG AGCAGCTGNA ATGCGGTTAA AAGCAAACTC AATGACTATG 
0241 GCGTGCAGGA ATGGAGTGCT CACACCAACA GGCGTGACCC TTCTGGCGAG GTGTCCTGGC 
0301 GCCTGAAAAA CGACACGAAG GCCGAATTTG TAACTGTGGC ATGGTGCAAG TTGTTCGAGT 
0361 GCCTGCATCG TTATCCATTG GTCACGAAGC CGGCTGTCAA CAGTATGCAT CTCTGCGAGG 
0421 CACCCGGTGC CTTCATAGCA TCTCTGAATC ATTACCTTCA TAGCAAATAT GAAAAGGATG 
0481 AGATTAAATG GNGCTGGCGC TC 
 in silico PCR Fragment
0001 AGCTTTCGTT CGTCTCCGCA GGGAAAGCCA CACCCAATGA CGGACTATCA GTCCATCCGG 
0061 CCTTCCGAAG TGGAGCAGCT CTTCGAGAAG AAGTTCCACT ATCAGAAGCC GAAAGGAAAC 
0121 AAATCCTGGC AGTTGCCGCC ACCGGATCAG GCTCTCTTCA GTGAGTTCTA CCAGTTCGAG 
0181 GCGCTGCA-G GGACTGCGCG AGCAGCTG-A ATGCGGTTAA AAGCAAACTC AATGACTATG 
0241 GCGTGCAGGA ATGGAGTGCT CACACCAACA GGCGTGACCC TTCTGGCGAG GTGTCCTGGC 
0301 GCCTGAAAAA CGACACGAAG GCCGAATTTG TAACTGTGGC ATGGTGCAAG TTGTTCGAGT 
0361 GCCTGCATCG TTATCCATTG GTCACGAAGC CGGCTGTCAA CAGTATGCAT CTCTGCGAGG 
0421 CACCCGGTGC CTTCATAGCA TCTCTGAATC ATTACCTTCA TAGCAAATAT GAAAAGGATG 
0481 AGATTAAATG GCGCTGGCGC TC 
 Assemble Data

5032R-1.IR_full       1   AGCTTTCGTTCGTCTCCGCAGGGAAAGCCACACCCAATGACGGACTATCAGTCCATCCGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5032R-1.in silico     1   AGCTTTCGTTCGTCTCCGCAGGGAAAGCCACACCCAATGACGGACTATCAGTCCATCCGG 60


5032R-1.IR_full       61  CCTTCCGAAGTGGAGCAGCTCTTCGAGAAGAAGTTCCACTATCAGAAGCCGAAAGGAAAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5032R-1.in silico     61  CCTTCCGAAGTGGAGCAGCTCTTCGAGAAGAAGTTCCACTATCAGAAGCCGAAAGGAAAC 120


5032R-1.IR_full       121 AAATCCTGGCAGTTGCCGCCACCGGATCAGGCTCTCTTCAGTGAGTTCTACCAGTTCGAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5032R-1.in silico     121 AAATCCTGGCAGTTGCCGCCACCGGATCAGGCTCTCTTCAGTGAGTTCTACCAGTTCGAG 180


5032R-1.IR_full       181 GCGCTGCAGGGGACTGCGCGAGCAGCTGNAATGCGGTTAAAAGCAAACTCAATGACTATG 240
                          |||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||
5032R-1.in silico     181 GCGCTGCA-GGGACTGCGCGAGCAGCTG-AATGCGGTTAAAAGCAAACTCAATGACTATG 240


5032R-1.IR_full       241 GCGTGCAGGAATGGAGTGCTCACACCAACAGGCGTGACCCTTCTGGCGAGGTGTCCTGGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5032R-1.in silico     241 GCGTGCAGGAATGGAGTGCTCACACCAACAGGCGTGACCCTTCTGGCGAGGTGTCCTGGC 300


5032R-1.IR_full       301 GCCTGAAAAACGACACGAAGGCCGAATTTGTAACTGTGGCATGGTGCAAGTTGTTCGAGT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5032R-1.in silico     301 GCCTGAAAAACGACACGAAGGCCGAATTTGTAACTGTGGCATGGTGCAAGTTGTTCGAGT 360


5032R-1.IR_full       361 GCCTGCATCGTTATCCATTGGTCACGAAGCCGGCTGTCAACAGTATGCATCTCTGCGAGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5032R-1.in silico     361 GCCTGCATCGTTATCCATTGGTCACGAAGCCGGCTGTCAACAGTATGCATCTCTGCGAGG 420


5032R-1.IR_full       421 CACCCGGTGCCTTCATAGCATCTCTGAATCATTACCTTCATAGCAAATATGAAAAGGATG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5032R-1.in silico     421 CACCCGGTGCCTTCATAGCATCTCTGAATCATTACCTTCATAGCAAATATGAAAAGGATG 480


5032R-1.IR_full       481 AGATTAAATGGNGCTGGCGCTC 502
                          ||||||||||| ||||||||||
5032R-1.in silico     481 AGATTAAATGGCGCTGGCGCTC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_058065.2  CG5032-RA (aft), mRNA 
0.2   NM_079502.2  CG1059-RA (Karybeta3), mRNA 
0   NM_169039.2  CG32464-RL, transcript variant L (l(3)82Fd), mRNA 
0   NM_143760.2  CG32464-RB, transcript variant B (l(3)82Fd), mRNA 
0   NM_001043213.1  CG32464-RP, transcript variant P (l(3)82Fd), mRNA 
0   NM_001031977.1  CG32464-RN, transcript variant N (l(3)82Fd), mRNA 
0   NM_169038.1  CG32464-RJ, transcript variant J (l(3)82Fd), mRNA 
0   NM_206429.1  CG32464-RG, transcript variant G (l(3)82Fd), mRNA 
0   NM_170640.2  CG32464-RK, transcript variant K (l(3)82Fd), mRNA 
0   NM_001043214.1  CG32464-RO, transcript variant O (l(3)82Fd), mRNA 
0   NM_169047.1  CG32464-RD, transcript variant D (l(3)82Fd), mRNA 
0   NM_165306.1  CG10186-RC, transcript variant C (CG10186), mRNA 
0   NM_136134.4  CG10186-RA, transcript variant A (CG10186), mRNA 
0   NM_167232.1  CG2890-RA, transcript variant A (PPP4R2r), mRNA 
0   NM_206677.1  CG2890-RC, transcript variant C (PPP4R2r), mRNA 
0   NM_080344.2  CG2890-RB, transcript variant B (PPP4R2r), mRNA 
0   NM_176356.1  CG9614-RF, transcript variant F (pip), mRNA 
0   NM_134688.1  CG11835-RA (CG11835), mRNA 
0   NM_136014.1  CG5681-RA (CG5681), mRNA 
0   NM_170256.1  CG8384-RC, transcript variant C (gro), mRNA 
0   NM_079790.3  CG8384-RD, transcript variant D (gro), mRNA 
0   NM_170254.1  CG8384-RA, transcript variant A (gro), mRNA 
0   NM_170255.2  CG8384-RB, transcript variant B (gro), mRNA 
0   NM_206575.1  CG8384-RE, transcript variant E (gro), mRNA 
0   NM_138050.2  CG3363-RA (CG3363), mRNA 
0   NM_078541.3  CG9022-RA (Ost48), mRNA 
0   NM_080535.2  CG9774-RA (rok), mRNA 
0   NM_130595.2  CG14816-RA (CG14816), mRNA 
0   NM_133037.2  CG7536-RA, transcript variant A (CG7536), mRNA 
0   NM_132171.1  CG12689-RA (CG12689), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.