National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4998R-1 
 Symbol CG4998  Full Name CG4998 
 CG No CG4998  Old CG No CG4998 
 Synonyms SPH66, CG4998 
 Accession No (Link to NCBI) NM_140621.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCAGTCGCCGATCTGTCGATA 
 Primer Seq. 3'
aatctagaggtaccTGGCGGTCCAAAGGAGTTCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCAGTCGCCG ATCTGTCGAT ACCAAGCCCG CCGAACAAGC TGACATTCAA GGACGTTACC 
0061 TCGTCCACGA GTCCATCCAG AGCAACAGCA CCACCCAGAT TGACGAGGTC ATCGAGCAGC 
0121 TGATCAACTC CCGCCGTGAG GGTCGTAATC TGGGGGAATA CGATGCCGTC TATGCTGATG 
0181 GCAATATCGA TCAGGCTCTG CAGCAGGGAA ACGATATGCA GGCCCGCAAT CTTATCCGGG 
0241 ATAAGCTGTG TGGATTGGGA CTGATGAGCT GCGATGTGGA GGAGAAGCGT CCCTTCTACT 
0301 CGACCATCTA TGCCCAGGGT CCCCCACCAC CATCCGGTTT CAGCGGTGGT CCCTATGGTC 
0361 CGGCTAAGCC CATGCCCCCA CCAAGCTACT TCAGTGGNTC GTCCACCAAT GGGTGGACCT 
0421 CCTGGATCTT ACGGACCTCC GCCAAGCTCC CTGAACTCCT TTGGACCTCC GCCCAGCTCC 
0481 GTGAACTCCT TTGGACCGCC G 
 in silico PCR Fragment
0001 CCAGTCGCCG ATCTGTCGAT ACCAAGCCCG CCGAACAAGC TGACATTCAG GGACGTTACC 
0061 TCGTCCACGA GTCCATCCAG AGCAACAGCA CCACCCAGAT TGACGAGGTC ATCGAGCAGC 
0121 TGATCAACTC CCGCCGTGAG GGTCGTAATC TGGGGGAATA CGATGCCGTC TATGCTGATG 
0181 GCAATATCGA TCAGGCTCTG CAGCAGGGAA ACGATATGCA GGCCCGCAAT CTTATCCGGG 
0241 ATAAGCTGTG TGGATTGGGA CTGATGAGCT GCGATGTGGA GGAGAAGCGT CCCTTCTACT 
0301 CGACCATCTA TGCCCAGGGT CCCCCACCAC CATCTGGTTT CAGCGGTGGT CCCTATGGTC 
0361 CGGCTAAGCC CATGCCCCCA CCAAGCTACT TCAGTGG-TC GTCCACCAAT GGGTGGACCT 
0421 CCTGGATCTT ACGGACCTCC GCCAAGCTCC CTGAACTCCT TTGGACCTCC GCCCAGCTCC 
0481 GTGAACTCCT TTGGACCGCC A 
 Assemble Data

4998R-1.IR_full       1   CCAGTCGCCGATCTGTCGATACCAAGCCCGCCGAACAAGCTGACATTCAAGGACGTTACC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
4998R-1.in silico     1   CCAGTCGCCGATCTGTCGATACCAAGCCCGCCGAACAAGCTGACATTCAGGGACGTTACC 60


4998R-1.IR_full       61  TCGTCCACGAGTCCATCCAGAGCAACAGCACCACCCAGATTGACGAGGTCATCGAGCAGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4998R-1.in silico     61  TCGTCCACGAGTCCATCCAGAGCAACAGCACCACCCAGATTGACGAGGTCATCGAGCAGC 120


4998R-1.IR_full       121 TGATCAACTCCCGCCGTGAGGGTCGTAATCTGGGGGAATACGATGCCGTCTATGCTGATG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4998R-1.in silico     121 TGATCAACTCCCGCCGTGAGGGTCGTAATCTGGGGGAATACGATGCCGTCTATGCTGATG 180


4998R-1.IR_full       181 GCAATATCGATCAGGCTCTGCAGCAGGGAAACGATATGCAGGCCCGCAATCTTATCCGGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4998R-1.in silico     181 GCAATATCGATCAGGCTCTGCAGCAGGGAAACGATATGCAGGCCCGCAATCTTATCCGGG 240


4998R-1.IR_full       241 ATAAGCTGTGTGGATTGGGACTGATGAGCTGCGATGTGGAGGAGAAGCGTCCCTTCTACT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4998R-1.in silico     241 ATAAGCTGTGTGGATTGGGACTGATGAGCTGCGATGTGGAGGAGAAGCGTCCCTTCTACT 300


4998R-1.IR_full       301 CGACCATCTATGCCCAGGGTCCCCCACCACCATCCGGTTTCAGCGGTGGTCCCTATGGTC 360
                          |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
4998R-1.in silico     301 CGACCATCTATGCCCAGGGTCCCCCACCACCATCTGGTTTCAGCGGTGGTCCCTATGGTC 360


4998R-1.IR_full       361 CGGCTAAGCCCATGCCCCCACCAAGCTACTTCAGTGGNTCGTCCACCAATGGGTGGACCT 420
                          ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
4998R-1.in silico     361 CGGCTAAGCCCATGCCCCCACCAAGCTACTTCAGTGG-TCGTCCACCAATGGGTGGACCT 420


4998R-1.IR_full       421 CCTGGATCTTACGGACCTCCGCCAAGCTCCCTGAACTCCTTTGGACCTCCGCCCAGCTCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4998R-1.in silico     421 CCTGGATCTTACGGACCTCCGCCAAGCTCCCTGAACTCCTTTGGACCTCCGCCCAGCTCC 480


4998R-1.IR_full       481 GTGAACTCCTTTGGACCGCCG 501
                          |||||||||||||||||||| 
4998R-1.in silico     481 GTGAACTCCTTTGGACCGCCA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  12  32  NM_001043144.1  CG4998-RB, transcript variant B (CG4998), mRNA 
100   482  12  32  NM_140621.1  CG4998-RA, transcript variant A (CG4998), mRNA 
0   NM_001031886.1  CG33692-RA, transcript variant A (CG33692), mRNA 
0   NM_001031889.1  CG33691-RA, transcript variant A (CG33691), mRNA 
0   NM_001031887.1  CG33691-RC, transcript variant C (CG33691), mRNA 
0   NM_130587.1  CG14799-RA (CG14799), mRNA 
0   NM_168124.1  CG10596-RC, transcript variant C (Msr-110), mRNA 
0   NM_168123.1  CG10596-RA, transcript variant A (Msr-110), mRNA 
0   NM_139716.2  CG10596-RB, transcript variant B (Msr-110), mRNA 
0   NM_130646.2  CG14045-RA (CG14045), mRNA 
0   NM_137785.1  CG9308-RA (CG9308), mRNA 
0   NM_137287.1  CG15712-RA (CG15712), mRNA 
0   NM_167431.1  CG15028-RA, transcript variant A (CG15028), mRNA 
0   NM_132779.1  CG15028-RB, transcript variant B (CG15028), mRNA 
0   NM_140438.2  CG32139-RA (Sox21b), mRNA 
0   NM_078981.2  CG8967-RA (otk), mRNA 
0   NM_136675.1  CG1625-RA (CG1625), mRNA 
0   NM_167643.1  CG32537-RA (CG32537), mRNA 
0   NM_136727.2  CG18408-RA, transcript variant A (CAP), mRNA 
0   NM_136073.2  CG18397-RA (CG18397), mRNA 
0   NM_080333.2  CG3346-RA (pon), mRNA 
0   NM_057949.3  CG10270-RA (D19B), mRNA 
0   NM_079817.2  CG1842-RA (Dhc98D), mRNA 
0   NM_079470.2  CG10564-RA (Ac78C), mRNA 
0   NM_168008.1  CG17746-RB, transcript variant B (CG17746), mRNA 
0   NM_139537.2  CG17746-RA, transcript variant A (CG17746), mRNA 
0   NM_166823.1  CG11059-RB, transcript variant B (cals), mRNA 
0   NM_079893.2  CG11059-RA, transcript variant A (cals), mRNA 
0   NM_137831.2  CG4752-RA (CG4752), mRNA 
0   NM_139464.2  CG32306-RB, transcript variant B (CG32306), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.