National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4974R-1 
 Symbol dally  Full Name division abnormally delayed 
 CG No CG4974  Old CG No CG4974 
 Synonyms CG4974, CT15952, gem, Dally, clone 1.63, l(3)06464, anon-EST:Liang-1.63, dally 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tseng CY, Su YH, Yang SM, Lin KY, Lai CM, Rastegari E, Amartuvshin O, Cho Y, Cai Y, Hsu HJ.
Smad-Independent BMP Signaling in Somatic Cells Limits the Size of the Germline Stem Cell Pool.
Stem Cell Reports (2018) 11(3) 811-827 [ PubMed ID = 30122445 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACCTGGATGGTATCCACCAC 
 Primer Seq. 3'
aatctagaggtaccCCCAGTTGGCCATTGCTGTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

4974R-1.IR full       1   ---------------------------------------------------------AGA 60
                                                                                   |||
4974R-1.in silico     1   GACCTGGATGGTATCCACCACCACCAGCACCACCTGCACAGCGCCACCACGCACCACAGA 60


4974R-1.IR full       61  CGTCGCCTACAGCGGGACTCGCGGNCGAAGGACGC-GTTGGGGGATCGACCCACCAGTGT 120
                          |||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||
4974R-1.in silico     61  CGTCGCCTACAGCGGGACTCGCGGGCGAAGGACGCCGTTGGGGGATCGACCCACCAGTGT 120


4974R-1.IR full       121 GATGCCGTCAAGAGCTACTTCGAATCGATCGACATCAAGTCGAGTGGGACTTACAGCGAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4974R-1.in silico     121 GATGCCGTCAAGAGCTACTTCGAATCGATCGACATCAAGTCGAGTGGGACTTACAGCGAA 180


4974R-1.IR full       181 AAAGGCGCCATTTGTGGCGGAAACTGCTGCAACAATGCCACGGAGCTGGAGCTGCGGGAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4974R-1.in silico     181 AAAGGCGCCATTTGTGGCGGAAACTGCTGCAACAATGCCACGGAGCTGGAGCTGCGGGAC 240


4974R-1.IR full       241 AAAGCCGCCGGAATGTTCGAGCAACTGCTTCATCATCACACCAGCAGCCTGCGCGGAGTC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4974R-1.in silico     241 AAAGCCGCCGGAATGTTCGAGCAACTGCTTCATCATCACACCAGCAGCCTGCGCGGAGTC 300


4974R-1.IR full       301 CTCGAGACGAATGCCAAACAGTTCCAAAGTCACGTCCTGGAATTGGCGCAGATTTCGGAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4974R-1.in silico     301 CTCGAGACGAATGCCAAACAGTTCCAAAGTCACGTCCTGGAATTGGCGCAGATTTCGGAG 360


4974R-1.IR full       361 AACATGACCCACTCGCTCTTTTCGAAGGTTTATACCCGTATGGTGCCTTCATCGCGTATG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4974R-1.in silico     361 AACATGACCCACTCGCTCTTTTCGAAGGTTTATACCCGTATGGTGCCTTCATCGCGTATG 420


4974R-1.IR full       421 ATGATCCATCAACTGTACACCGAAATCATGAACCATCTGATTTACACCTCCAACTATACG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4974R-1.in silico     421 ATGATCCATCAACTGTACACCGAAATCATGAACCATCTGATTTACACCTCCAACTATACG 480


4974R-1.IR full       481 AACAGCAATGGCCAACTGGG 500
                          ||||||||||||||||||||
4974R-1.in silico     481 AACAGCAATGGCCAACTGGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_079259.2  division abnormally delayed CG4974-RA (dally), mRNA 
0.82  NM_079321.2  araucan CG10571-RA (ara), mRNA 
0.82  19  NM_143061.1  tenectin CG13648-RA (tnc), mRNA 
0.62  12  29  52  NM_143342.1  CG5514-RB, transcript variant B (CG5514), mRNA 
0.62  12  29  52  NM_170361.1  CG5514-RA, transcript variant A (CG5514), mRNA 
0.41  17  18  NM_057805.2  toucan CG9660-RA, transcript variant A (toc), mRNA 
0.41  14  15  NM_176229.1  CG33147-RA (CG33147), mRNA 
0.41  12  NM_135286.1  CG6739-RA (CG6739), mRNA 
0.2  13  21  NM_080362.2  SAM-motif ubiquitously expressed punctatedly localized protein CG31868-RA (Samuel), mRNA 
0.2  20  NM_132370.1  CG2989-RA (CG2989), mRNA 
0.2  48  NM_134527.1  CG15322-RA (CG15322), mRNA 
0.2  30  NM_132004.2  CG4136-RA (CG4136), mRNA 
0.2  13  NM_132498.1  CG1572-RA, transcript variant A (CG1572), mRNA 
0.2  13  NM_167289.1  CG1572-RB, transcript variant B (CG1572), mRNA 
0.2  10  NM_057980.3  Accessory gland-specific peptide 32CD CG4605-RA (Acp32CD), mRNA 
0.2  NM_167023.1  CG32770-RA (CG32770), mRNA 
10  12  37  NM_132391.2  CG15307-RA (CG15307), mRNA 
29  38  NM_140417.2  CG17364-RA, transcript variant A (CG17364), mRNA 
29  38  NM_176328.1  CG17364-RB, transcript variant B (CG17364), mRNA 
19  47  NM_137672.1  CG15225-RA (CG15225), mRNA 
15  33  NM_132214.1  CG15335-RB (CG15335), mRNA 
28  NM_143571.2  CG15544-RA (CG15544), mRNA 
24  NM_078544.2  lozenge CG1689-RA (lz), mRNA 
14  47  NM_134552.3  RhoGAP19D CG1412-RA (RhoGAP19D), mRNA 
13  34  NM_169047.1  l(3)82Fd CG32464-RD, transcript variant D (l(3)82Fd), mRNA 
11  29  NM_132009.2  CG11473-RA (CG11473), mRNA 
27  NM_206663.1  CG12075-RB, transcript variant B (CG12075), mRNA 
27  NM_132278.2  CG12075-RA, transcript variant A (CG12075), mRNA 
21  NM_143633.1  CG2187-RA (CG2187), mRNA 
33  NM_080120.2  male-specific opa containing gene CG14560-RA (msopa), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.