National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4934R-1 
 Symbol brn  Full Name brainiac 
 CG No CG4934  Old CG No CG4934 
 Synonyms brc, l(1)6P6, fs(1)107, fs(1)A107, EG:EG0007.6, CG4934, brn 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAACACCGCAAACTGCTGCTG 
 Primer Seq. 3'
aatctagaggtaccAACTCGCTGCGATTGAACTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

4934R-1.IR full       1   AAANACCGCAAACTGCTGCTGCGCTGCCTCCTGGTGCTGCCCCTCATCCTTCTGGTGGAC 60
                          ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4934R-1.in silico     1   AAACACCGCAAACTGCTGCTGCGCTGCCTCCTGGTGCTGCCCCTCATCCTTCTGGTGGAC 60


4934R-1.IR full       61  TATTGCGGCCTGCTGACCCACCTGCACGAGCTGAACTTCGAGCGGCACTTTCACTACCCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4934R-1.in silico     61  TATTGCGGCCTGCTGACCCACCTGCACGAGCTGAACTTCGAGCGGCACTTTCACTACCCG 120


4934R-1.IR full       121 CTGAACGATGACACTGGATCTGGGTCCGCATCCTCTGGACTGGACAAGTTCGCCTACCTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4934R-1.in silico     121 CTGAACGATGACACTGGATCTGGGTCCGCATCCTCTGGACTGGACAAGTTCGCCTACCTG 180


4934R-1.IR full       181 CGAGTGCCCTCGTTCACGGCAGAGGTGCCGGTTGACCAGCCTGCGCGGCTCACGATGCTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4934R-1.in silico     181 CGAGTGCCCTCGTTCACGGCAGAGGTGCCGGTTGACCAGCCTGCGCGGCTCACGATGCTC 240


4934R-1.IR full       241 ATAAAGAGTGCGGTGGGCAATTCGCGACGTCGGGAGGCCATTCGCCGGACTTGGGGCTAC 300
                          |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
4934R-1.in silico     241 ATAAAGAGCGCGGTGGGCAATTCGCGACGTCGGGAGGCCATTCGCCGGACTTGGGGCTAC 300


4934R-1.IR full       301 GAGGGTCGATTCTCAGACGTCCATCTGCGTCGCGTGTTCCTGCTGGGCACGGCCGAGGAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4934R-1.in silico     301 GAGGGTCGATTCTCAGACGTCCATCTGCGTCGCGTGTTCCTGCTGGGCACGGCCGAGGAT 360


4934R-1.IR full       361 AGTGAGAAAGACGTGGCTTGGGAGTCCCGCGAGCATGGCGACATTCTGCAGGCGGAGTTC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4934R-1.in silico     361 AGTGAGAAAGACGTGGCTTGGGAGTCCCGCGAGCATGGCGACATTCTGCAGGCGGAGTTC 420


4934R-1.IR full       421 ACGGACGCCTACTTCAACAACACGCTGAAAACCATGCTGGGTATGCGCTGGGCTAGCGAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4934R-1.in silico     421 ACGGACGCCTACTTCAACAACACGCTGAAAACCATGCTGGGTATGCGCTGGGCTAGCGAT 480


4934R-1.IR full       481 CAGTTCAATCGCAGCGAGTT 500
                          ||||||||||||||||||||
4934R-1.in silico     481 CAGTTCAATCGCAGCGAGTT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_057553.3  brainiac CG4934-RA (brn), mRNA 
NM_079626.2  Corazonin CG3302-RA (Crz), mRNA 
NM_139845.2  CG8605-RA (CG8605), mRNA 
NM_136135.2  CG10132-RA (CG10132), mRNA 
NM_140745.1  CG6052-RA (CG6052), mRNA 
NM_141819.1  CG5281-RA (CG5281), mRNA 
NM_140259.1  CG5917-RA (CG5917), mRNA 
NM_057832.3  apontic CG5393-RA, transcript variant A (apt), mRNA 
NM_166609.1  apontic CG5393-RC, transcript variant C (apt), mRNA 
NM_057831.3  apontic CG5393-RB, transcript variant B (apt), mRNA 
NM_166611.1  apontic CG5393-RE, transcript variant E (apt), mRNA 
NM_166610.1  apontic CG5393-RD, transcript variant D (apt), mRNA 
NM_001031899.1  CG33639-RA (CG33639), mRNA 
NM_141653.2  CG16789-RA (CG16789), mRNA 
NM_166207.1  Apaf-1-related-killer CG6829-RB, transcript variant B (Ark), mRNA 
NM_080313.2  egghead CG9659-RC, transcript variant C (egh), mRNA 
NM_136800.1  CG13218-RA (CG13218), mRNA 
NM_078853.2  Tektin A CG4767-RA (Tektin-A), mRNA 
NM_169783.1  couch potato CG31243-RB, transcript variant B (cpo), mRNA 
NM_169781.1  couch potato CG31243-RE, transcript variant E (cpo), mRNA 
NM_080105.2  couch potato CG31243-RF, transcript variant F (cpo), mRNA 
NM_169782.1  couch potato CG31243-RA, transcript variant A (cpo), mRNA 
NM_166031.1  CG8233-RA, transcript variant A (CG8233), mRNA 
NM_137083.2  CG8233-RB, transcript variant B (CG8233), mRNA 
NM_166032.1  CG8233-RC, transcript variant C (CG8233), mRNA 
NM_206683.2  discs large 1 CG1725-RB, transcript variant B (dlg1), mRNA 
NM_206681.2  discs large 1 CG1725-RH, transcript variant H (dlg1), mRNA 
NM_167282.2  discs large 1 CG1725-RA, transcript variant A (dlg1), mRNA 
NM_078565.3  discs large 1 CG1725-RD, transcript variant D (dlg1), mRNA 
NM_206682.2  discs large 1 CG1725-RG, transcript variant G (dlg1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.