National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4916R-2 
 Symbol me31B  Full Name maternal expression at 31B 
 CG No CG4916  Old CG No CG4916 
 Synonyms Me31B, CG4916, ME31B, DmRH3, l(2)k06607, me31B, Me31b, Dhh1p/Me31b 
 Accession No (Link to NCBI) NM_078809.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Lee J, Yoo E, Lee H, Park K, Hur JH, Lim C.
LSM12 and ME31B/DDX6 Define Distinct Modes of Posttranscriptional Regulation by ATAXIN-2 Protein Complex in Drosophila Circadian Pacemaker Neurons.
Mol. Cell (2017) 66(1) 129-140.e7 [ PubMed ID = 28388438 ] [ RRC reference ]

Barbee SA, Estes PS, Cziko AM, Hillebrand J, Luedeman RA, Coller JM, Johnson N, Howlett IC, Geng C, Ueda R, Brand AH, Newbury SF, Wilhelm JE, Levine RB, Nakamura A, Parker R, Ramaswami M.
Staufen- and FMRP-containing neuronal RNPs are structurally and functionally related to somatic P bodies.
Neuron (2006) 52(6) 997-1009 [ PubMed ID = 17178403 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTATTGCCACTCCCGGACGAA 
 Primer Seq. 3'
aatctagaggtaccACAGAGTCCTTGGCGGAAATC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTATTGCCAC TCCCGGACGA ATATTAGATC TGATGGATAA GAAAGTTGCC GATATGTCGC 
0061 ATTGCAGAAT ATTAGTTTTG GATGAGGCCG ATAAGCTATT GTCGCTTGAT TTTCAAGGCA 
0121 TGCTGGATCA TGTTATACTA AAGTTACCAA AGGATCCACA GATCTTGCTA TTTTCCGCAA 
0181 CATTTCCACT AACAGTCAAG AATTTCATGG AGAAGCATTT ACGCGAGCCT TACGAGATCA 
0241 ACCTGATGGA GGAGCTAACA CTGAAGGGTG TCACTCAGTA CTATGCATTC GTACAGGAGC 
0301 GCCAGAAAGT ACACTGCTTG AATACGCTCT TTTCGAAGCT GCAGATCAAT CAGTCTATCA 
0361 TATTCTGCAA TTCCACGCAA CGTGTCGAGC TATTGGCCAA AAAGATCACA GAGCTTGGAT 
0421 ATTGCTGTTA CTATATACAC GCNTAAGATG GCCCAGGCAC ACAGAAATCG AGTATTCCAC 
0481 GATTTCCGCC AAGGACTCTG T 
 in silico PCR Fragment
0001 TTATTGCCAC TCCCGGACGA ATATTAGATC TGATGGATAA GAAAGTTGCC GATATGTCGC 
0061 ATTGCAGAAT ATTAGTTTTG GATGAGGCCG ATAAGCTATT GTCGCTTGAT TTTCAAGGCA 
0121 TGCTGGATCA TGTTATACTA AAGTTACCAA AGGATCCACA GATCTTGCTA TTTTCCGCAA 
0181 CATTTCCACT AACAGTCAAG AATTTCATGG AGAAGCATTT ACGCGAGCCT TACGAGATCA 
0241 ACCTGATGGA GGAGCTAACA CTGAAGGGTG TCACTCAGTA CTATGCATTC GTACAGGAGC 
0301 GCCAGAAAGT ACACTGCTTG AATACGCTCT TTTCGAAGCT GCAGATCAAT CAGTCTATCA 
0361 TATTCTGCAA TTCCACGCAA CGTGTCGAGC TATTGGCCAA AAAGATCACA GAGCTTGGAT 
0421 ATTGCTGTTA CTATATACAC GC-TAAGATG GCCCAGGCAC ACAGAAATCG AGTATTCCAC 
0481 GATTTCCGCC AAGGACTCTG T 
 Assemble Data

4916R-2.IR_full       1   TTATTGCCACTCCCGGACGAATATTAGATCTGATGGATAAGAAAGTTGCCGATATGTCGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4916R-2.in silico     1   TTATTGCCACTCCCGGACGAATATTAGATCTGATGGATAAGAAAGTTGCCGATATGTCGC 60


4916R-2.IR_full       61  ATTGCAGAATATTAGTTTTGGATGAGGCCGATAAGCTATTGTCGCTTGATTTTCAAGGCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4916R-2.in silico     61  ATTGCAGAATATTAGTTTTGGATGAGGCCGATAAGCTATTGTCGCTTGATTTTCAAGGCA 120


4916R-2.IR_full       121 TGCTGGATCATGTTATACTAAAGTTACCAAAGGATCCACAGATCTTGCTATTTTCCGCAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4916R-2.in silico     121 TGCTGGATCATGTTATACTAAAGTTACCAAAGGATCCACAGATCTTGCTATTTTCCGCAA 180


4916R-2.IR_full       181 CATTTCCACTAACAGTCAAGAATTTCATGGAGAAGCATTTACGCGAGCCTTACGAGATCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4916R-2.in silico     181 CATTTCCACTAACAGTCAAGAATTTCATGGAGAAGCATTTACGCGAGCCTTACGAGATCA 240


4916R-2.IR_full       241 ACCTGATGGAGGAGCTAACACTGAAGGGTGTCACTCAGTACTATGCATTCGTACAGGAGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4916R-2.in silico     241 ACCTGATGGAGGAGCTAACACTGAAGGGTGTCACTCAGTACTATGCATTCGTACAGGAGC 300


4916R-2.IR_full       301 GCCAGAAAGTACACTGCTTGAATACGCTCTTTTCGAAGCTGCAGATCAATCAGTCTATCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4916R-2.in silico     301 GCCAGAAAGTACACTGCTTGAATACGCTCTTTTCGAAGCTGCAGATCAATCAGTCTATCA 360


4916R-2.IR_full       361 TATTCTGCAATTCCACGCAACGTGTCGAGCTATTGGCCAAAAAGATCACAGAGCTTGGAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4916R-2.in silico     361 TATTCTGCAATTCCACGCAACGTGTCGAGCTATTGGCCAAAAAGATCACAGAGCTTGGAT 420


4916R-2.IR_full       421 ATTGCTGTTACTATATACACGCNTAAGATGGCCCAGGCACACAGAAATCGAGTATTCCAC 480
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
4916R-2.in silico     421 ATTGCTGTTACTATATACACGC-TAAGATGGCCCAGGCACACAGAAATCGAGTATTCCAC 480


4916R-2.IR_full       481 GATTTCCGCCAAGGACTCTGT 501
                          |||||||||||||||||||||
4916R-2.in silico     481 GATTTCCGCCAAGGACTCTGT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078809.2  CG4916-RA, transcript variant A (me31B), mRNA 
100   482  NM_164898.1  CG4916-RB, transcript variant B (me31B), mRNA 
0   NM_079817.2  CG1842-RA (Dhc98D), mRNA 
0   NM_135011.2  CG15631-RA (CG15631), mRNA 
0   NM_001038795.1  CG8683-RA (CG8683), mRNA 
0   NM_206610.1  CG14047-RB, transcript variant B (CG14047), mRNA 
0   NM_130645.2  CG14047-RA, transcript variant A (CG14047), mRNA 
0   NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_057796.2  CG10379-RA (mbc), mRNA 
0   NM_165492.1  CG3287-RC, transcript variant C (CG3287), mRNA 
0   NM_165491.1  CG3287-RB, transcript variant B (CG3287), mRNA 
0   NM_136443.2  CG1620-RA (CG1620), mRNA 
0   NM_078773.2  CG31628-RA, transcript variant A (ade3), mRNA 
0   NM_165928.1  CG8811-RB, transcript variant B (muskelin), mRNA 
0   NM_136957.2  CG8811-RA, transcript variant A (muskelin), mRNA 
0   NM_057393.3  CG3158-RA (spn-E), mRNA 
0   NM_057679.4  CG5371-RA (RnrL), mRNA 
0   NM_057258.2  CG10699-RA, transcript variant A (Lim3), mRNA 
0   NM_165277.1  CG10699-RB, transcript variant B (Lim3), mRNA 
0   NM_132370.1  CG2989-RA (CG2989), mRNA 
0   NM_080167.3  CG9074-RA (Mst57Da), mRNA 
0   NM_001014725.1  CG4027-RD, transcript variant D (Act5C), mRNA 
0   NM_001014726.1  CG4027-RC, transcript variant C (Act5C), mRNA 
0   NM_176735.1  CG33206-RB, transcript variant B (l(1)G0168), mRNA 
0   NM_176734.1  CG33206-RA, transcript variant A (l(1)G0168), mRNA 
0   NM_165342.3  CG9326-RB, transcript variant B (CG9326), mRNA 
0   NM_206011.2  CG9326-RD, transcript variant D (CG9326), mRNA 
0   NM_143375.1  CG14061-RA (CG14061), mRNA 
0   NM_001014620.1  CG9918-RD (CG9918), mRNA 
0   NM_166177.2  CG15925-RA (CG15925), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.