National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4916R-1 
 Symbol me31B  Full Name maternal expression at 31B 
 CG No CG4916  Old CG No CG4916 
 Synonyms Me31B, CG4916, ME31B, DmRH3, l(2)k06607, me31B, Me31b, Dhh1p/Me31b 
 Accession No (Link to NCBI) NM_078809.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Hillebrand J, Pan K, Kokaram A, Barbee S, Parker R, Ramaswami M.
The Me31B DEAD-Box Helicase Localizes to Postsynaptic Foci and Regulates Expression of a CaMKII Reporter mRNA in Dendrites of Drosophila Olfactory Projection Neurons.
Front Neural Circuits (2010) 4 121 [ PubMed ID = 21267420 ] [ RRC reference ]

Sudhakaran IP, Hillebrand J, Dervan A, Das S, Holohan EE, Hülsmeier J, Sarov M, Parker R, VijayRaghavan K, Ramaswami M.
FMRP and Ataxin-2 function together in long-term olfactory habituation and neuronal translational control.
Proc. Natl. Acad. Sci. U.S.A. (2014) 111(1) E99-E108 [ PubMed ID = 24344294 ] [ RRC reference ]

McCann C, Holohan EE, Das S, Dervan A, Larkin A, Lee JA, Rodrigues V, Parker R, Ramaswami M.
The Ataxin-2 protein is required for microRNA function and synapse-specific long-term olfactory habituation.
Proc. Natl. Acad. Sci. U.S.A. (2011) 108(36) E655-62 [ PubMed ID = 21795609 ] [ RRC reference ]

Barbee SA, Estes PS, Cziko AM, Hillebrand J, Luedeman RA, Coller JM, Johnson N, Howlett IC, Geng C, Ueda R, Brand AH, Newbury SF, Wilhelm JE, Levine RB, Nakamura A, Parker R, Ramaswami M.
Staufen- and FMRP-containing neuronal RNPs are structurally and functionally related to somatic P bodies.
Neuron (2006) 52(6) 997-1009 [ PubMed ID = 17178403 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TTATTGCCACTCCCGGACGAATATTAGATCTGATGGATAAGAAAGTTGCCGATATGTCGC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATTGCAGAATATTAGTTTTGGATGAGGCCGATAAGCTATTGTCGCTTGATTTTCAAGGCA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGCTGGATCATGTTATACTAAAGTTACCAAAGGATCCACAGATCTTGCTATTTTCCGCAA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CATTTCCACTAACAGTCAAGAATTTCATGGAGAAGCATTTACGCGAGCCTTACGAGATCA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ACCTGATGGAGGAGCTAACACTGAAGGGTGTCACTCAGTACTATGCATTCGTACAGGAGC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCCAGAAAGTACACTGCTTGAATACGCTCTTTTCGAAGCTGCAGATCAATCAGTCTATCA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TATTCTGCAATTCCACGCAACGTGTCGAGCTATTGGCCAAAAAGATCACAGAGCTTGGAT 420

                          |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| silico     421 ATTGCTGTTACTATATACACGC-TAAGATGGCCCAGGCACACAGAAATCGAGTATTCCAC 480

4916R-1.IR_full       481 GATTTCCGCCAAGGACTCTGT 501
                          ||||||||||||||||||||| silico     481 GATTTCCGCCAAGGACTCTGT 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078809.2  CG4916-RA, transcript variant A (me31B), mRNA 
100   482  NM_164898.1  CG4916-RB, transcript variant B (me31B), mRNA 
0   NM_079817.2  CG1842-RA (Dhc98D), mRNA 
0   NM_135011.2  CG15631-RA (CG15631), mRNA 
0   NM_001038795.1  CG8683-RA (CG8683), mRNA 
0   NM_206610.1  CG14047-RB, transcript variant B (CG14047), mRNA 
0   NM_130645.2  CG14047-RA, transcript variant A (CG14047), mRNA 
0   NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_057796.2  CG10379-RA (mbc), mRNA 
0   NM_165492.1  CG3287-RC, transcript variant C (CG3287), mRNA 
0   NM_165491.1  CG3287-RB, transcript variant B (CG3287), mRNA 
0   NM_136443.2  CG1620-RA (CG1620), mRNA 
0   NM_078773.2  CG31628-RA, transcript variant A (ade3), mRNA 
0   NM_165928.1  CG8811-RB, transcript variant B (muskelin), mRNA 
0   NM_136957.2  CG8811-RA, transcript variant A (muskelin), mRNA 
0   NM_057393.3  CG3158-RA (spn-E), mRNA 
0   NM_057679.4  CG5371-RA (RnrL), mRNA 
0   NM_057258.2  CG10699-RA, transcript variant A (Lim3), mRNA 
0   NM_165277.1  CG10699-RB, transcript variant B (Lim3), mRNA 
0   NM_132370.1  CG2989-RA (CG2989), mRNA 
0   NM_080167.3  CG9074-RA (Mst57Da), mRNA 
0   NM_001014725.1  CG4027-RD, transcript variant D (Act5C), mRNA 
0   NM_001014726.1  CG4027-RC, transcript variant C (Act5C), mRNA 
0   NM_176735.1  CG33206-RB, transcript variant B (l(1)G0168), mRNA 
0   NM_176734.1  CG33206-RA, transcript variant A (l(1)G0168), mRNA 
0   NM_165342.3  CG9326-RB, transcript variant B (CG9326), mRNA 
0   NM_206011.2  CG9326-RD, transcript variant D (CG9326), mRNA 
0   NM_143375.1  CG14061-RA (CG14061), mRNA 
0   NM_001014620.1  CG9918-RD (CG9918), mRNA 
0   NM_166177.2  CG15925-RA (CG15925), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.