National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4905R-1 
 Symbol Syn2  Full Name Syntrophin-like 2 
 CG No CG4905  Old CG No CG4905 
 Synonyms CG4905, DmSYN-2, Syn2 
 Accession No (Link to NCBI) NM_166179.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Nagai R, Hashimoto R, Tanaka Y, Taguchi O, Sato M, Matsukage A, Yamaguchi M.
Syntrophin-2 is required for eye development in Drosophila.
Exp. Cell Res. (2010) 316(2) 272-85 [ PubMed ID = 19836389 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCATGGCCACGCCTATAGAA 
 Primer Seq. 3'
aatctagaggtaccTCGGGTGTGTCCTTGGTCAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCATGGCCA CGcCTATAGA AGAAAAACTC GACCAAAACC TGAAGGTGCG AACTGGAATG 
0061 GTGCACGTGA GCGATGGCAA GAGCAGACCA GAACCGCTTC GACTTAATCT TACCATGGAG 
0121 TTGCTTTCGC TGCAGAAGCT GGAAGTGGTA ACACCAAGTA GTTGTCACCC CAATGGACCA 
0181 CCCATGGAAT CAAAGGAACG TATGGTTCAA ATTACGCGCC AAAAACAAGG CGGCCTAGGA 
0241 CTGAGCATAA AAGGTGGCGC CGAGCATAAA CTACCCATTT TGATATCGCG TATCTATAAG 
0301 GATCAGGCTG CGGACATAAC GGGCCAACTA TTTGNTGGCG ATGCCATCAT CAAGGTCAAC 
0361 GGAGAATACA TCACGGCATG TCCTCACGAT GATGCCGTCA ATATATTGAG AAACGCTGGC 
0421 GATATTGTTG TGCTCACTGT TAAGCATTAT cGNGCAgNCA CGCCTTTCCT TCAGAAACAA 
0481 CTGACCAAGG ACACACCCGA  
 in silico PCR Fragment
0001 ACCATGGCCA CGCCTATAGA AGAAAAACTC GACCAAAACC TGAAGGTGCG AACTGGAATG 
0061 GTGCACGTGA GCGATGGCAA GAGCAGACCA GAACCGCTTC GACTTAATCT TACCATGGAG 
0121 TTGCTTTCGC TGCAGAAGCT GGAAGTGGTA ACACCAAGTA GTTGTCACCC CAATGGACCA 
0181 CCCATGGAAT CAAAGGAACG TATGGTTCAA ATTACGCGCC AAAAACAAGG CGGCCTAGGA 
0241 CTGAGCATAA AAGGTGGCGC CGAGCATAAA CTACCCATTT TGATATCGCG TATCTATAAG 
0301 GATCAGGCTG CGGACATAAC GGGCCAACTA TTTGTTGGCG ATGCCATCAT CAAGGTCAAC 
0361 GGAGAATACA TCACGGCATG TCCTCACGAT GATGCCGTCA ATATATTGAG AAACGCTGGC 
0421 GATATTGTTG TGCTCACTGT TAAGCATTAT CGCGCAGCCA CGCCTTTCCT TCAGAAACAA 
0481 CTGACCAAGG ACACACCCGA  
 Assemble Data

4905R-1.IR_full       1   ACCATGGCCACGCCTATAGAAGAAAAACTCGACCAAAACCTGAAGGTGCGAACTGGAATG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4905R-1.in silico     1   ACCATGGCCACGCCTATAGAAGAAAAACTCGACCAAAACCTGAAGGTGCGAACTGGAATG 60


4905R-1.IR_full       61  GTGCACGTGAGCGATGGCAAGAGCAGACCAGAACCGCTTCGACTTAATCTTACCATGGAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4905R-1.in silico     61  GTGCACGTGAGCGATGGCAAGAGCAGACCAGAACCGCTTCGACTTAATCTTACCATGGAG 120


4905R-1.IR_full       121 TTGCTTTCGCTGCAGAAGCTGGAAGTGGTAACACCAAGTAGTTGTCACCCCAATGGACCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4905R-1.in silico     121 TTGCTTTCGCTGCAGAAGCTGGAAGTGGTAACACCAAGTAGTTGTCACCCCAATGGACCA 180


4905R-1.IR_full       181 CCCATGGAATCAAAGGAACGTATGGTTCAAATTACGCGCCAAAAACAAGGCGGCCTAGGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4905R-1.in silico     181 CCCATGGAATCAAAGGAACGTATGGTTCAAATTACGCGCCAAAAACAAGGCGGCCTAGGA 240


4905R-1.IR_full       241 CTGAGCATAAAAGGTGGCGCCGAGCATAAACTACCCATTTTGATATCGCGTATCTATAAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4905R-1.in silico     241 CTGAGCATAAAAGGTGGCGCCGAGCATAAACTACCCATTTTGATATCGCGTATCTATAAG 300


4905R-1.IR_full       301 GATCAGGCTGCGGACATAACGGGCCAACTATTTGNTGGCGATGCCATCATCAAGGTCAAC 360
                          |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
4905R-1.in silico     301 GATCAGGCTGCGGACATAACGGGCCAACTATTTGTTGGCGATGCCATCATCAAGGTCAAC 360


4905R-1.IR_full       361 GGAGAATACATCACGGCATGTCCTCACGATGATGCCGTCAATATATTGAGAAACGCTGGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4905R-1.in silico     361 GGAGAATACATCACGGCATGTCCTCACGATGATGCCGTCAATATATTGAGAAACGCTGGC 420


4905R-1.IR_full       421 GATATTGTTGTGCTCACTGTTAAGCATTATCGNGCAGNCACGCCTTTCCTTCAGAAACAA 480
                          |||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||
4905R-1.in silico     421 GATATTGTTGTGCTCACTGTTAAGCATTATCGCGCAGCCACGCCTTTCCTTCAGAAACAA 480


4905R-1.IR_full       481 CTGACCAAGGACACACCCGA 500
                          ||||||||||||||||||||
4905R-1.in silico     481 CTGACCAAGGACACACCCGA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166179.2  CG4905-RA, transcript variant A (Syn2), mRNA 
100   482  NM_166180.2  CG4905-RB, transcript variant B (Syn2), mRNA 
100   482  NM_176201.1  CG4905-RE, transcript variant E (Syn2), mRNA 
96.26   464  NM_166181.2  CG4905-RD, transcript variant D (Syn2), mRNA 
96.26   464  NM_079038.3  CG4905-RC, transcript variant C (Syn2), mRNA 
0   NM_078970.3  CG12351-RA (deltaTry), mRNA 
0   NM_165824.1  CG30031-RA (CG30031), mRNA 
0   NM_165825.1  CG30025-RA (CG30025), mRNA 
0   NM_165823.1  CG30028-RA (gammaTry), mRNA 
0   NM_132239.1  CG1632-RA (CG1632), mRNA 
0   12  NM_001043297.1  CG3339-RB, transcript variant B (CG3339), mRNA 
0   10  NM_143300.1  CG3339-RA, transcript variant A (CG3339), mRNA 
0   NM_079609.2  CG6019-RA (mus308), mRNA 
0   NM_140807.2  CG6856-RA (CG6856), mRNA 
0   NM_143801.2  CG5935-RB, transcript variant B (Dek), mRNA 
0   NM_166198.1  CG5935-RC, transcript variant C (Dek), mRNA 
0   NM_166199.2  CG5935-RA, transcript variant A (Dek), mRNA 
0   NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_001032080.1  CG33695-RA, transcript variant A (CG33695), mRNA 
0   NM_001032076.1  CG33694-RA, transcript variant A (cana), mRNA 
0   NM_132184.1  CG15327-RA (CG15327), mRNA 
0   NM_142221.1  CG18516-RA (CG18516), mRNA 
0   NM_137794.2  CG11073-RA (CG11073), mRNA 
0   NM_132079.1  CG15897-RA (CG15897), mRNA 
0   NM_001032022.1  CG11779-RD, transcript variant D (CG11779), mRNA 
0   NM_142529.3  CG11779-RA, transcript variant A (CG11779), mRNA 
0   NM_169849.1  CG11779-RB, transcript variant B (CG11779), mRNA 
0   NM_132198.2  CG1530-RA (CG1530), mRNA 
0   NM_138049.2  CG3328-RA (CG3328), mRNA 
0   NM_135915.1  CG11865-RA (CG11865), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.