National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4878R-3 
 Symbol eIF3-S9  Full Name eIF3-S9 
 CG No CG4878  Old CG No CG4878 
 Synonyms cg4878, CG4878, eIF3-S9 
 Accession No (Link to NCBI) NM_166239.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Jia D, Soylemez M, Calvin G, Bornmann R, Bryant J, Hanna C, Huang YC, Deng WM.
A large-scale in vivo RNAi screen to identify genes involved in Notch-mediated follicle cell differentiation and cell cycle switches.
Sci Rep (2015) 5 12328 [ PubMed ID = 26205122 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGACAGTGATTACCAGGAGGA 
 Primer Seq. 3'
aatctagaggtaccCCACGCAGTACTGGTCATAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGACAGTGAT TACCAGGAGG AGCCGAACTT TGACGATCNC GCCCGGGTTC GTGGACAACA 
0061 TTAGTGATGA AGATNCTGCT GGGCGACATG TTGGCCCAGC GCCCCTCGGA GGCCGATGGC 
0121 GTCGAGAGTG TGGTGGTAGT GGACAATATC CCAAAGGTGG AGCCGGTGCG CCTGGAGAAG 
0181 CTGAAGTTGG TCATCAACAA GCTGTTTTCG AACTACGGAG ATATCGTCAA TGTGGTCTAT 
0241 CCCGTCGACG AGGAGGGCAA GACCAAGGGC TACGCCTTCA TGGAGTACAA GCAGGCCAGA 
0301 CAGGCGGAGG AAGCCGTCAA GAAGCTCAAC AATCATCGCC TAGACAAAAA CCACACCTTT 
0361 GCCGTCAATC TCTTCACCGA TTTCCAAAAG TACGAAAACA TCCCCGAGAA GTGGGAGCCG 
0421 CCAACCGTGC AGACCTTCAA AGTGCAGAGC GATCTATACA ACTTCATCAA TGACCCGGAC 
0481 ACTTATGACC AGTACTGCGT GG 
 in silico PCR Fragment
0001 CGACAGTGAT TACCAGGAGG AGCCGAACTT TGACGATC-C GCCCGGGTTC GTGGACAACA 
0061 TTAGTGATGA AGAT-CTGCT GGGCGACATG TTGGCCCAGC GCCCCTCGGA GGCCGATGGC 
0121 GTCGAGAGTG TGGTGGTAGT GGACAATATC CCAAAGGTGG AGCCGGTGCG CCTGGAGAAG 
0181 CTGAAGTTGG TCATCAACAA GCTGTTTTCG AACTACGGAG AAATCGTCAA TGTGGTCTAT 
0241 CCCGTCGACG AGGAGGGCAA GACCAAGGGC TACGCCTTCA TGGAGTACAA GCAGGCCAGA 
0301 CAGGCGGAGG AAGCCGTCAA GAAGCTCAAC AATCATCGCC TAGACAAAAA CCACACCTTT 
0361 GCCGTCAATC TCTTCACCGA TTTCCAAAAG TACGAAAACA TCCCCGAGAA GTGGGAGCCG 
0421 CCAACCGTGC AGACCTTCAA AGTGCAGAGC GATCTATACA ACTTCATCAA TGACCCGGAC 
0481 ACTTATGACC AGTACTGCGT GG 
 Assemble Data

4878R-3.IR_full       1   CGACAGTGATTACCAGGAGGAGCCGAACTTTGACGATCNCGCCCGGGTTCGTGGACAACA 60
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
4878R-3.in silico     1   CGACAGTGATTACCAGGAGGAGCCGAACTTTGACGATC-CGCCCGGGTTCGTGGACAACA 60


4878R-3.IR_full       61  TTAGTGATGAAGATNCTGCTGGGCGACATGTTGGCCCAGCGCCCCTCGGAGGCCGATGGC 120
                          |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
4878R-3.in silico     61  TTAGTGATGAAGAT-CTGCTGGGCGACATGTTGGCCCAGCGCCCCTCGGAGGCCGATGGC 120


4878R-3.IR_full       121 GTCGAGAGTGTGGTGGTAGTGGACAATATCCCAAAGGTGGAGCCGGTGCGCCTGGAGAAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4878R-3.in silico     121 GTCGAGAGTGTGGTGGTAGTGGACAATATCCCAAAGGTGGAGCCGGTGCGCCTGGAGAAG 180


4878R-3.IR_full       181 CTGAAGTTGGTCATCAACAAGCTGTTTTCGAACTACGGAGATATCGTCAATGTGGTCTAT 240
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
4878R-3.in silico     181 CTGAAGTTGGTCATCAACAAGCTGTTTTCGAACTACGGAGAAATCGTCAATGTGGTCTAT 240


4878R-3.IR_full       241 CCCGTCGACGAGGAGGGCAAGACCAAGGGCTACGCCTTCATGGAGTACAAGCAGGCCAGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4878R-3.in silico     241 CCCGTCGACGAGGAGGGCAAGACCAAGGGCTACGCCTTCATGGAGTACAAGCAGGCCAGA 300


4878R-3.IR_full       301 CAGGCGGAGGAAGCCGTCAAGAAGCTCAACAATCATCGCCTAGACAAAAACCACACCTTT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4878R-3.in silico     301 CAGGCGGAGGAAGCCGTCAAGAAGCTCAACAATCATCGCCTAGACAAAAACCACACCTTT 360


4878R-3.IR_full       361 GCCGTCAATCTCTTCACCGATTTCCAAAAGTACGAAAACATCCCCGAGAAGTGGGAGCCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4878R-3.in silico     361 GCCGTCAATCTCTTCACCGATTTCCAAAAGTACGAAAACATCCCCGAGAAGTGGGAGCCG 420


4878R-3.IR_full       421 CCAACCGTGCAGACCTTCAAAGTGCAGAGCGATCTATACAACTTCATCAATGACCCGGAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4878R-3.in silico     421 CCAACCGTGCAGACCTTCAAAGTGCAGAGCGATCTATACAACTTCATCAATGACCCGGAC 480


4878R-3.IR_full       481 ACTTATGACCAGTACTGCGTGG 502
                          ||||||||||||||||||||||
4878R-3.in silico     481 ACTTATGACCAGTACTGCGTGG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166239.2  CG4878-RA, transcript variant A (eIF3-S9), mRNA 
100   482  NM_137384.2  CG4878-RB, transcript variant B (eIF3-S9), mRNA 
0.2   NM_057857.4  CG8749-RA (snRNP70K), mRNA 
0   NM_142809.2  CG6937-RA (CG6937), mRNA 
0   NM_167239.2  CG32677-RA (CG32677), mRNA 
0   NM_167164.2  CG12737-RB, transcript variant B (Crag), mRNA 
0   NM_080341.2  CG12737-RA, transcript variant A (Crag), mRNA 
0   NM_170639.1  CG17122-RA (CG17122), mRNA 
0   11  NM_176362.1  CG8789-RB, transcript variant B (CG8789), mRNA 
0   11  NM_176363.1  CG8789-RC, transcript variant C (CG8789), mRNA 
0   11  NM_140880.2  CG8789-RA, transcript variant A (CG8789), mRNA 
0   NM_165354.1  CG9264-RB, transcript variant B (CG9264), mRNA 
0   NM_136238.2  CG9264-RA, transcript variant A (CG9264), mRNA 
0   NM_001042852.1  CG12500-RB, transcript variant B (stnA), mRNA 
0   NM_001042851.1  CG12500-RA, transcript variant A (stnA), mRNA 
0   NM_001042854.1  CG12473-RB, transcript variant B (stnB), mRNA 
0   NM_001042853.1  CG12473-RA, transcript variant A (stnB), mRNA 
0   NM_140669.2  CG9715-RA (CG9715), mRNA 
0   NM_169487.1  CG31342-RA (CG31342), mRNA 
0   NM_139961.1  CG7120-RA (CG7120), mRNA 
0   10  NM_167848.1  CG18214-RD, transcript variant D (trio), mRNA 
0   NM_206228.1  CG18214-RF, transcript variant F (trio), mRNA 
0   NM_167850.1  CG18214-RE, transcript variant E (trio), mRNA 
0   NM_167849.1  CG18214-RB, transcript variant B (trio), mRNA 
0   NM_143703.2  CG18214-RA, transcript variant A (trio), mRNA 
0   NM_167847.1  CG18214-RC, transcript variant C (trio), mRNA 
0   NM_135016.2  CG3225-RA (CG3225), mRNA 
0   NM_135199.2  CG31637-RA (CG31637), mRNA 
0   NM_079702.2  CG3637-RA (Cortactin), mRNA 
0   NM_143452.1  CG1911-RA (CAP-D2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.