National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4826R-2 
 Symbol CG31743  Full Name CG31743 
 CG No CG31743  Old CG No CG4826 
 Synonyms 152851_at, CG4826, CG31743 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGAACCATCTACACGCAAG 
 Primer Seq. 3'
aatctagaggtaccACGACGAAGACGCTCTTCGCA 
 Predicted Fragment Size
510 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

4826R-2.IR full       1   ATGGAACCATCTACACGCAAGGAGAAAAGAACGGAAAGGAATAATGTGCTGACCTACAAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4826R-2.in silico     1   ATGGAACCATCTACACGCAAGGAGAAAAGAACGGAAAGGAATAATGTGCTGACCTACAAG 60


4826R-2.IR full       61  AAACTGCGGAAAATGCCACTCAATTTACGCAAACAGGCAGTTCGAGAGGCTCGCAATAGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4826R-2.in silico     61  AAACTGCGGAAAATGCCACTCAATTTACGCAAACAGGCAGTTCGAGAGGCTCGCAATAGA 120


4826R-2.IR full       121 AACGAACCAATTCTCGGAAAGAAAAAGAAGCGGAAGACAAATCCCCGGTTTTTTAGGACT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4826R-2.in silico     121 AACGAACCAATTCTCGGAAAGAAAAAGAAGCGGAAGACAAATCCCCGGTTTTTTAGGACT 180


4826R-2.IR full       181 GCCCGCCGCCTGCGGAACGACTTTGATCGATCCGAACACAAAGCCATGTTGGCCAGCACT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4826R-2.in silico     181 GCCCGCCGCCTGCGGAACGACTTTGATCGATCCGAACACAAAGCCATGTTGGCCAGCACT 240


4826R-2.IR full       241 TCCGAGGAGCTACGACGCATCCTGCAGGATGTTGAGACTCTCTCGGACATTCCGCACGAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4826R-2.in silico     241 TCCGAGGAGCTACGACGCATCCTGCAGGATGTTGAGACTCTCTCGGACATTCCGCACGAT 300


4826R-2.IR full       301 ATAACAAACGTCGAACTGCAAGGGGAGATAGCCATCGCCGAGGGACGGGCCACAACGATC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4826R-2.in silico     301 ATAACAAACGTCGAACTGCAAGGGGAGATAGCCATCGCCGAGGGACGGGCCACAACGATC 360


4826R-2.IR full       361 TATGTGCAGCGAGATGGACTCAGCACCCTGACAGTGGTGCTCCACCAGCACGAGCCCACG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4826R-2.in silico     361 TATGTGCAGCGAGATGGACTCAGCACCCTGACAGTGGTGCTCCACCAGCACGAGCCCACG 420


4826R-2.IR full       421 ATCGCTCAGCTGAAGAGGGCAATTGCTTTGATCTCACGGGCCCAGCACAAGCGCAGCCAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4826R-2.in silico     421 ATCGCTCAGCTGAAGAGGGCAATTGCTTTGATCTCACGGGCCCAGCACAAGCGCAGCCAA 480


4826R-2.IR full       481 CGCGAGCGGTGCGAAGAGCGTCTTCGTCGT 510
                          ||||||||||||||||||||||||||||||
4826R-2.in silico     481 CGCGAGCGGTGCGAAGAGCGTCTTCGTCGT 510

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  492  NM_135976.2  CG31743-RA (CG31743), mRNA 
0.2  NM_137217.2  tungus CG8253-RA (tun), mRNA 
NM_142947.2  CG5933-RA (CG5933), mRNA 
NM_057378.2  small wing CG4200-RA (sl), mRNA 
NM_140378.2  SoxNeuro Co-Factor CG14112-RA (SNCF), mRNA 
NM_168770.1  CG32199-RA (CG32199), mRNA 
NM_141937.1  CG17202-RA (CG17202), mRNA 
NM_169275.1  Fps oncogene analog CG8874-RC, transcript variant C (Fps85D), mRNA 
NM_169274.1  Fps oncogene analog CG8874-RB, transcript variant B (Fps85D), mRNA 
NM_079564.3  Fps oncogene analog CG8874-RA, transcript variant A (Fps85D), mRNA 
NM_168511.1  CG10984-RC, transcript variant C (CG10984), mRNA 
NM_168510.1  CG10984-RB, transcript variant B (CG10984), mRNA 
NM_140336.2  CG10984-RA, transcript variant A (CG10984), mRNA 
NM_169090.1  CG2182-RB, transcript variant B (CG2182), mRNA 
NM_141313.1  CG2182-RA, transcript variant A (CG2182), mRNA 
NM_001038786.1  CG33995-RB, transcript variant B (CG33995), mRNA 
NM_142471.1  CG7691-RA (CG7691), mRNA 
NM_169638.2  Tropomyosin 1 CG4898-RE, transcript variant E (Tm1), mRNA 
NM_169639.2  Tropomyosin 1 CG4898-RH, transcript variant H (Tm1), mRNA 
NM_169640.1  Tropomyosin 1 CG4898-RC, transcript variant C (Tm1), mRNA 
NM_169641.2  Tropomyosin 1 CG4898-RI, transcript variant I (Tm1), mRNA 
NM_057791.3  derailed CG17348-RA (drl), mRNA 
NM_134894.2  CG3542-RA, transcript variant A (CG3542), mRNA 
NM_164521.1  CG3542-RB, transcript variant B (CG3542), mRNA 
NM_001032051.1  Muscle-specific protein 300 CG33715-RD, transcript variant D (Msp-300), mRNA 
NM_142248.2  CG31183-RA (CG31183), mRNA 
NM_139917.2  CG7927-RA (CG7927), mRNA 
NM_143722.2  ENL/AF9-related CG4913-RA (ear), mRNA 
NM_132490.2  CG1745-RB, transcript variant B (CG1745), mRNA 
NM_079775.3  Male-specific RNA 57Db CG5016-RA (Mst57Db), mRNA 
100  482  NM_135976.2  CG31743-RA (CG31743), mRNA 
NM_135684.1  CG16965-RA (CG16965), mRNA 
NM_169696.1  serpent CG3992-RA, transcript variant A (srp), mRNA 
NM_169694.1  serpent CG3992-RB, transcript variant B (srp), mRNA 
NM_136553.2  Cirl CG8639-RA (Cirl), mRNA 
NM_176373.1  CG5976-RA, transcript variant A (CG5976), mRNA 
NM_176372.1  CG5976-RB, transcript variant B (CG5976), mRNA 
NM_136039.2  CG10211-RA (CG10211), mRNA 
NM_168724.1  Cad74A CG6445-RB, transcript variant B (Cad74A), mRNA 
NM_140716.1  Cad74A CG6445-RA, transcript variant A (Cad74A), mRNA 
NM_165949.1  Diacyl glycerol kinase epsilon CG8657-RA (Dgkepsilon), mRNA 
NM_134920.1  CG8837-RA (CG8837), mRNA 
NM_176557.1  multiple ankyrin repeats single KH domain CG33106-RB, transcript variant B (mask), mRNA 
NM_176556.1  multiple ankyrin repeats single KH domain CG33106-RA, transcript variant A (mask), mRNA 
NM_137061.2  CG6337-RA (CG6337), mRNA 
NM_206278.1  still life CG5406-RC, transcript variant C (sif), mRNA 
NM_079908.2  still life CG5406-RA, transcript variant A (sif), mRNA 
NM_132933.2  CG9609-RA (CG9609), mRNA 
NM_132647.1  Inositol 1,4,5-triphosphate kinase 2 CG1630-RA, transcript variant A (IP3K2), mRNA 
NM_167358.1  Inositol 1,4,5-triphosphate kinase 2 CG1630-RB, transcript variant B (IP3K2), mRNA 
NM_138063.2  CG13578-RA (CG13578), mRNA 
NM_143348.2  CG4849-RA (CG4849), mRNA 
NM_136672.2  CG1688-RA (CG1688), mRNA 
NM_142661.2  CG17273-RA (CG17273), mRNA 
NM_168240.1  CG32365-RA (CG32365), mRNA 
NM_165680.1  CG1814-RC, transcript variant C (CG1814), mRNA 
NM_166010.1  female lethal d CG6315-RB, transcript variant B (fl(2)d), mRNA 
NM_136655.2  CG1814-RA, transcript variant A (CG1814), mRNA 
NM_165679.1  CG1814-RB, transcript variant B (CG1814), mRNA 
NM_138041.2  CG4049-RA (CG4049), mRNA 
100  482  NM_135976.2  CG31743-RA (CG31743), mRNA 
11  NM_170629.2  CG32352-RC, transcript variant C (CG32352), mRNA 
11  NM_168279.2  CG32352-RA, transcript variant A (CG32352), mRNA 
11  NM_168278.1  CG32352-RB, transcript variant B (CG32352), mRNA 
NM_141937.1  CG17202-RA (CG17202), mRNA 
NM_079564.3  Fps oncogene analog CG8874-RA, transcript variant A (Fps85D), mRNA 
NM_169274.1  Fps oncogene analog CG8874-RB, transcript variant B (Fps85D), mRNA 
NM_169275.1  Fps oncogene analog CG8874-RC, transcript variant C (Fps85D), mRNA 
NM_167346.1  hemipterous CG4353-RA, transcript variant A (hep), mRNA 
NM_078587.2  hemipterous CG4353-RC, transcript variant C (hep), mRNA 
10  NM_001032051.1  Muscle-specific protein 300 CG33715-RD, transcript variant D (Msp-300), mRNA 
NM_132335.2  CG12139-RB (CG12139), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.