National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4826R-1 
 Symbol CG31743  Full Name CG31743 
 CG No CG31743  Old CG No CG4826 
 Synonyms 152851_at, CG4826, CG31743 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGAACCATCTACACGCAAG 
 Primer Seq. 3'
aatctagaggtaccACGACGAAGACGCTCTTCGCA 
 Predicted Fragment Size
510 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

4826R-1.IR full       1   ATGGAACCATCTACACGCAAGGAGAAAAGAACGGAAAGGAATAATGTGCTGACCTACAAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4826R-1.in silico     1   ATGGAACCATCTACACGCAAGGAGAAAAGAACGGAAAGGAATAATGTGCTGACCTACAAG 60


4826R-1.IR full       61  AAACTGCGGAAAATGCCACTCAATTTACGCAAACAGGCAGTTCGAGAGGCTCGCAATAGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4826R-1.in silico     61  AAACTGCGGAAAATGCCACTCAATTTACGCAAACAGGCAGTTCGAGAGGCTCGCAATAGA 120


4826R-1.IR full       121 AACGAACCAATTCTCGGAAAGAAAAAGAAGCGGAAGACAAATCCCCGGTTTTTTAGGACT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4826R-1.in silico     121 AACGAACCAATTCTCGGAAAGAAAAAGAAGCGGAAGACAAATCCCCGGTTTTTTAGGACT 180


4826R-1.IR full       181 GCCCGCCGCCTGCGGAACGACTTTGATCGATCCGAACACAAAGCCATGTTGGCCAGCACT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4826R-1.in silico     181 GCCCGCCGCCTGCGGAACGACTTTGATCGATCCGAACACAAAGCCATGTTGGCCAGCACT 240


4826R-1.IR full       241 TCCGAGGAGCTACGACGCATCCTGCAGGATGTTGAGACTCTCTCGGACATTCCGCACGAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4826R-1.in silico     241 TCCGAGGAGCTACGACGCATCCTGCAGGATGTTGAGACTCTCTCGGACATTCCGCACGAT 300


4826R-1.IR full       301 ATAACAAACGTCGAACTGCAAGGGGAGATAGCCATCGCCGAGGGACGGGCCACAACGATC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4826R-1.in silico     301 ATAACAAACGTCGAACTGCAAGGGGAGATAGCCATCGCCGAGGGACGGGCCACAACGATC 360


4826R-1.IR full       361 TATGTGCAGCGAGATGGACTCAGCACCCTGACAGTGGTGCTCCACCAGCACGAGCCCACG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4826R-1.in silico     361 TATGTGCAGCGAGATGGACTCAGCACCCTGACAGTGGTGCTCCACCAGCACGAGCCCACG 420


4826R-1.IR full       421 ATCGCTCAGCTGAAGAGGGCAATTGCTTTGATCTCACGGGCCCAGCACAAGCGCAGCCAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4826R-1.in silico     421 ATCGCTCAGCTGAAGAGGGCAATTGCTTTGATCTCACGGGCCCAGCACAAGCGCAGCCAA 480


4826R-1.IR full       481 CGCGAGCGGTGCGAAGAGCGTCTTCGTCGT 510
                          ||||||||||||||||||||||||||||||
4826R-1.in silico     481 CGCGAGCGGTGCGAAGAGCGTCTTCGTCGT 510

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  492  NM_135976.2  CG31743-RA (CG31743), mRNA 
0.2  NM_137217.2  tungus CG8253-RA (tun), mRNA 
NM_142947.2  CG5933-RA (CG5933), mRNA 
NM_057378.2  small wing CG4200-RA (sl), mRNA 
NM_140378.2  SoxNeuro Co-Factor CG14112-RA (SNCF), mRNA 
NM_168770.1  CG32199-RA (CG32199), mRNA 
NM_141937.1  CG17202-RA (CG17202), mRNA 
NM_169275.1  Fps oncogene analog CG8874-RC, transcript variant C (Fps85D), mRNA 
NM_169274.1  Fps oncogene analog CG8874-RB, transcript variant B (Fps85D), mRNA 
NM_079564.3  Fps oncogene analog CG8874-RA, transcript variant A (Fps85D), mRNA 
NM_168511.1  CG10984-RC, transcript variant C (CG10984), mRNA 
NM_168510.1  CG10984-RB, transcript variant B (CG10984), mRNA 
NM_140336.2  CG10984-RA, transcript variant A (CG10984), mRNA 
NM_169090.1  CG2182-RB, transcript variant B (CG2182), mRNA 
NM_141313.1  CG2182-RA, transcript variant A (CG2182), mRNA 
NM_001038786.1  CG33995-RB, transcript variant B (CG33995), mRNA 
NM_142471.1  CG7691-RA (CG7691), mRNA 
NM_169638.2  Tropomyosin 1 CG4898-RE, transcript variant E (Tm1), mRNA 
NM_169639.2  Tropomyosin 1 CG4898-RH, transcript variant H (Tm1), mRNA 
NM_169640.1  Tropomyosin 1 CG4898-RC, transcript variant C (Tm1), mRNA 
NM_169641.2  Tropomyosin 1 CG4898-RI, transcript variant I (Tm1), mRNA 
NM_057791.3  derailed CG17348-RA (drl), mRNA 
NM_134894.2  CG3542-RA, transcript variant A (CG3542), mRNA 
NM_164521.1  CG3542-RB, transcript variant B (CG3542), mRNA 
NM_001032051.1  Muscle-specific protein 300 CG33715-RD, transcript variant D (Msp-300), mRNA 
NM_142248.2  CG31183-RA (CG31183), mRNA 
NM_139917.2  CG7927-RA (CG7927), mRNA 
NM_143722.2  ENL/AF9-related CG4913-RA (ear), mRNA 
NM_132490.2  CG1745-RB, transcript variant B (CG1745), mRNA 
NM_079775.3  Male-specific RNA 57Db CG5016-RA (Mst57Db), mRNA 
100  482  NM_135976.2  CG31743-RA (CG31743), mRNA 
NM_135684.1  CG16965-RA (CG16965), mRNA 
NM_169696.1  serpent CG3992-RA, transcript variant A (srp), mRNA 
NM_169694.1  serpent CG3992-RB, transcript variant B (srp), mRNA 
NM_136553.2  Cirl CG8639-RA (Cirl), mRNA 
NM_176373.1  CG5976-RA, transcript variant A (CG5976), mRNA 
NM_176372.1  CG5976-RB, transcript variant B (CG5976), mRNA 
NM_136039.2  CG10211-RA (CG10211), mRNA 
NM_168724.1  Cad74A CG6445-RB, transcript variant B (Cad74A), mRNA 
NM_140716.1  Cad74A CG6445-RA, transcript variant A (Cad74A), mRNA 
NM_165949.1  Diacyl glycerol kinase epsilon CG8657-RA (Dgkepsilon), mRNA 
NM_134920.1  CG8837-RA (CG8837), mRNA 
NM_176557.1  multiple ankyrin repeats single KH domain CG33106-RB, transcript variant B (mask), mRNA 
NM_176556.1  multiple ankyrin repeats single KH domain CG33106-RA, transcript variant A (mask), mRNA 
NM_137061.2  CG6337-RA (CG6337), mRNA 
NM_206278.1  still life CG5406-RC, transcript variant C (sif), mRNA 
NM_079908.2  still life CG5406-RA, transcript variant A (sif), mRNA 
NM_132933.2  CG9609-RA (CG9609), mRNA 
NM_132647.1  Inositol 1,4,5-triphosphate kinase 2 CG1630-RA, transcript variant A (IP3K2), mRNA 
NM_167358.1  Inositol 1,4,5-triphosphate kinase 2 CG1630-RB, transcript variant B (IP3K2), mRNA 
NM_138063.2  CG13578-RA (CG13578), mRNA 
NM_143348.2  CG4849-RA (CG4849), mRNA 
NM_136672.2  CG1688-RA (CG1688), mRNA 
NM_142661.2  CG17273-RA (CG17273), mRNA 
NM_168240.1  CG32365-RA (CG32365), mRNA 
NM_165680.1  CG1814-RC, transcript variant C (CG1814), mRNA 
NM_166010.1  female lethal d CG6315-RB, transcript variant B (fl(2)d), mRNA 
NM_136655.2  CG1814-RA, transcript variant A (CG1814), mRNA 
NM_165679.1  CG1814-RB, transcript variant B (CG1814), mRNA 
NM_138041.2  CG4049-RA (CG4049), mRNA 
100  482  NM_135976.2  CG31743-RA (CG31743), mRNA 
11  NM_170629.2  CG32352-RC, transcript variant C (CG32352), mRNA 
11  NM_168279.2  CG32352-RA, transcript variant A (CG32352), mRNA 
11  NM_168278.1  CG32352-RB, transcript variant B (CG32352), mRNA 
NM_141937.1  CG17202-RA (CG17202), mRNA 
NM_079564.3  Fps oncogene analog CG8874-RA, transcript variant A (Fps85D), mRNA 
NM_169274.1  Fps oncogene analog CG8874-RB, transcript variant B (Fps85D), mRNA 
NM_169275.1  Fps oncogene analog CG8874-RC, transcript variant C (Fps85D), mRNA 
NM_167346.1  hemipterous CG4353-RA, transcript variant A (hep), mRNA 
NM_078587.2  hemipterous CG4353-RC, transcript variant C (hep), mRNA 
10  NM_001032051.1  Muscle-specific protein 300 CG33715-RD, transcript variant D (Msp-300), mRNA 
NM_132335.2  CG12139-RB (CG12139), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.