National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4825R-3 
 Symbol CG4825  Full Name CG4825 
 CG No CG4825  Old CG No CG4825 
 Synonyms CG4825 
 Accession No (Link to NCBI) NM_140985.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yang X, Liang J, Ding L, Li X, Lam SM, Shui G, Ding M, Huang X.
Phosphatidylserine synthase regulates cellular homeostasis through distinct metabolic mechanisms.
PLoS Genet. (2019) 15(12) e1008548 [ PubMed ID = 31869331 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCACTAATTCACGTGGCACCC 
 Primer Seq. 3'
aatctagaggtaccTTGTAGCGTCAGCAGGTACAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCACTTAATT CACGTGGCAC CCCGACCTCG TCgGGCGTAC GCGCTACTGG ACACCTCCTT 
0061 CTCCTCCGCC GGCGATGCTG AGCGGGATCA TCCCGCCTAC AAATCAGGCG CGGCCAGTGC 
0121 CCCTGCCACG CCCACCAAGC GACGGGATGG CAGCGATGGC AGTGTCAGCA GCGCGGGAGC 
0181 ACGCAGGAAG CGCAAGGACG AGATCGCCCA GACATTTGTG ATCGTCAACG AACGTCCCGT 
0241 GGACGACATA TCGCTGGACT TCTTCTACAA GCCACACACC ATCACCTTGC TGGCTGTTTC 
0301 GGTGCTCGCC GTCATGTACT TTGCGTTCGT CAGAAACGAG GCGAACGTGG ATGAGAATCT 
0361 CTGGGCCGGC CTCCTCTGCA TTGTGTTCTT CTTTCTGATC GTCTCGGTGA TTGCATTTCC 
0421 CAATGGACCC TTCACACGAC CCCATCCCGC CGTCTGGCGG ATATTATTCG GATGCTCTGT 
0481 GCTGTACCTG CTGACGCTAC AA 
 in silico PCR Fragment
0001 GCAC-TAATT CACGTGGCAC CCCGACCTCG TCGGGCG-AC GCGCTACTGG ACACCTCCTT 
0061 CTCCTCCGCC GGCGATGCTG AGCGGGATCA TCCCGCCTAC AAATCAGGCG CGGCCAGTGC 
0121 CCCTGCCACG CCCACCAAGC GACGGGATGG CAGCGATGGC AGTGTCAGCA GCGCGGGAGC 
0181 ACGCAGGAAG CGCAAGGACG AGATCGCCCA GACATTTGTG ATCGTCAACG AACGTCCCGT 
0241 GGACGACATA TCGCTGGACT TCTTCTACAA GCCACACACC ATCACCTTGC TGGCTGTTTC 
0301 GGTGCTCGCC GTCATGTACT TTGCGTTCGT CAGAAACGAG GCGAACGTGG ATGAGAATCT 
0361 CTGGGCCGGC CTCCTCTGCA TTGTGTTCTT CTTTCTGATC GTCTCGGTGA TTGCATTTCC 
0421 CAATGGACCC TTCACACGAC CCCATCCCGC CGTCTGGCGG ATATTATTCG GATGCTCTGT 
0481 GCTGTACCTG CTGACGCTAC AA 
 Assemble Data

4825R-3.IR_full       1   GCACTTAATTCACGTGGCACCCCGACCTCGTCGGGCGTACGCGCTACTGGACACCTCCTT 60
                          |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||
4825R-3.in silico     1   GCAC-TAATTCACGTGGCACCCCGACCTCGTCGGGCG-ACGCGCTACTGGACACCTCCTT 60


4825R-3.IR_full       61  CTCCTCCGCCGGCGATGCTGAGCGGGATCATCCCGCCTACAAATCAGGCGCGGCCAGTGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4825R-3.in silico     61  CTCCTCCGCCGGCGATGCTGAGCGGGATCATCCCGCCTACAAATCAGGCGCGGCCAGTGC 120


4825R-3.IR_full       121 CCCTGCCACGCCCACCAAGCGACGGGATGGCAGCGATGGCAGTGTCAGCAGCGCGGGAGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4825R-3.in silico     121 CCCTGCCACGCCCACCAAGCGACGGGATGGCAGCGATGGCAGTGTCAGCAGCGCGGGAGC 180


4825R-3.IR_full       181 ACGCAGGAAGCGCAAGGACGAGATCGCCCAGACATTTGTGATCGTCAACGAACGTCCCGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4825R-3.in silico     181 ACGCAGGAAGCGCAAGGACGAGATCGCCCAGACATTTGTGATCGTCAACGAACGTCCCGT 240


4825R-3.IR_full       241 GGACGACATATCGCTGGACTTCTTCTACAAGCCACACACCATCACCTTGCTGGCTGTTTC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4825R-3.in silico     241 GGACGACATATCGCTGGACTTCTTCTACAAGCCACACACCATCACCTTGCTGGCTGTTTC 300


4825R-3.IR_full       301 GGTGCTCGCCGTCATGTACTTTGCGTTCGTCAGAAACGAGGCGAACGTGGATGAGAATCT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4825R-3.in silico     301 GGTGCTCGCCGTCATGTACTTTGCGTTCGTCAGAAACGAGGCGAACGTGGATGAGAATCT 360


4825R-3.IR_full       361 CTGGGCCGGCCTCCTCTGCATTGTGTTCTTCTTTCTGATCGTCTCGGTGATTGCATTTCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4825R-3.in silico     361 CTGGGCCGGCCTCCTCTGCATTGTGTTCTTCTTTCTGATCGTCTCGGTGATTGCATTTCC 420


4825R-3.IR_full       421 CAATGGACCCTTCACACGACCCCATCCCGCCGTCTGGCGGATATTATTCGGATGCTCTGT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4825R-3.in silico     421 CAATGGACCCTTCACACGACCCCATCCCGCCGTCTGGCGGATATTATTCGGATGCTCTGT 480


4825R-3.IR_full       481 GCTGTACCTGCTGACGCTACAA 502
                          ||||||||||||||||||||||
4825R-3.in silico     481 GCTGTACCTGCTGACGCTACAA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140985.2  CG4825-RA (CG4825), mRNA 
0.41   NM_141801.1  CG17184-RA, transcript variant A (CG17184), mRNA 
0.41   NM_169381.1  CG17184-RB, transcript variant B (CG17184), mRNA 
0.2   NM_176229.1  CG33147-RA (CG33147), mRNA 
0   NM_206207.1  CG5472-RC, transcript variant C (Pal), mRNA 
0   NM_206208.1  CG5472-RB, transcript variant B (Pal), mRNA 
0   NM_080379.3  CG5472-RA, transcript variant A (Pal), mRNA 
0   NM_080223.2  CG3986-RA (Cht4), mRNA 
0   NM_078559.2  CG18085-RA (sev), mRNA 
0   16  NM_167401.1  CG1517-RB, transcript variant B (na), mRNA 
0   16  NM_167402.1  CG1517-RC, transcript variant C (na), mRNA 
0   11  NM_079093.2  CG9888-RA (Fib), mRNA 
0   NM_001038902.1  CG33993-RA (CG33993), mRNA 
0   NM_140285.2  CG32096-RD, transcript variant D (rols), mRNA 
0   NM_168487.1  CG32096-RB, transcript variant B (rols), mRNA 
0   NM_168490.1  CG32096-RE, transcript variant E (rols), mRNA 
0   NM_168278.1  CG32352-RB, transcript variant B (CG32352), mRNA 
0   NM_168488.1  CG32096-RA, transcript variant A (rols), mRNA 
0   NM_168279.2  CG32352-RA, transcript variant A (CG32352), mRNA 
0   NM_168489.1  CG32096-RC, transcript variant C (rols), mRNA 
0   NM_170629.2  CG32352-RC, transcript variant C (CG32352), mRNA 
0   NM_142188.2  CG6276-RA (CG6276), mRNA 
0   NM_140574.1  CG13075-RA (CG13075), mRNA 
0   NM_078875.2  CG10446-RA (Side), mRNA 
0   NM_057969.3  CG9635-RD, transcript variant D (RhoGEF2), mRNA 
0   NM_206146.1  CG9635-RF, transcript variant F (RhoGEF2), mRNA 
0   NM_206147.1  CG9635-RE, transcript variant E (RhoGEF2), mRNA 
0   NM_176246.1  CG33143-RC, transcript variant C (CG33143), mRNA 
0   NM_176247.1  CG33143-RB, transcript variant B (CG33143), mRNA 
0   NM_132825.2  CG8128-RA (CG8128), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.