National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4821R-1 
 Symbol Tequila  Full Name Tequila 
 CG No CG4821  Old CG No CG4821 
 Synonyms CG4948, CG18403, graal, SP72, CG18153, CK00198, anon-EST:ParkEST161, CG4821, BEST:GH18038, BEST:CK00198, Tequila, Teq, teq 
 Accession No (Link to NCBI) NM_140031.1 
 Inserted Chr. ll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGTATTGGTGCCTCCGCCTTT 
 Primer Seq. 3'
aatctagaggtaccCAGGCGCATGCCAATTGGTTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGTATTGGTG CCTCCGCCTT TCGACCATAA GTTTTATAGT CCTCAGTCGA CAAATCCAAG 
0061 CATTAATCGA AATCAATCTG CATCTGGTCC CAACTCCCAA GCGGCAATTA AAGAAGCTCT 
0121 TAAGCTTATG CTGCGTCCCT ATTTCAATCA CAGTGGGAAT GCCCAAGAGC AACTTGCCCA 
0181 ACAGGCTGAA TCGGCTATAG TGTCTGTGAT TAGTAAAGGC GGTCAACCCA CTACCACCCA 
0241 CCACACCAAG GCCAACTTTC CAAGACACCT AAAACAGACC CNTGACTTTT GACGCCGAAC 
0301 TTATTAAAAG CGGGTGAACA GGAAAGCTTG GATTCCGTTG ACGACGACTA TGTTTTTCCA 
0361 GATGCCAGGG AGACGTCCCG AACCGAGCAG ACCCTAGATC CCAGTACCAC ATACGCCTCG 
0421 ACAAACTTTC AACGGAGCAC TCGCAGGGCT GAGTTAGATC CTGACACCCT AACCGCAACT 
0481 ACAATGAAAA CCAATTGGCA TGcGCCTG 
 in silico PCR Fragment
0001 TGTATTGGTG CCTCCGCCTT TCGACCATAA GTTTTATAGT CCTCAGTCGA CAAATCCAAG 
0061 CATTAATCGA AATCAATCTG CATCTGGTCC CAACTCCCAA GCGGCAATTA AAGAAGCTCT 
0121 TAAGCTTATG CTGCGTCCCT ATTTCAATCA CAGTGGGAAT GCCCAAGAGC AACTTGCTCA 
0181 ACAGGCTGAA TCGGCTATAG TGTCTGTAAT TAGTAA--GC CGTCAA-CCA CTACCA-CCA 
0241 CCACACCAAG GCCAAC-TTC CAAGACACCT AAAACAGACC C-TGAC-TTT GACGCCGAAC 
0301 TTATT-AAAG CGGGTGAACA GGAAAGCTTG GATTCCGTTG ACGACGACTA TGTTTTTCCA 
0361 GATGCCAGGG AGACGTCCCG AACCGAGCAG ACCCTAGATC CCAGTACCAC ATACGCCTCG 
0421 ACAAACTTTC AACGGAGCAC TCGCAGGGCT GAGTTAGATC CTGACACCCT AACCGCAACT 
0481 ACAATGAAAA CCAATTGGCA TGCGCCTG 
 Assemble Data

4821R-1.IR_full       1   TGTATTGGTGCCTCCGCCTTTCGACCATAAGTTTTATAGTCCTCAGTCGACAAATCCAAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4821R-1.in silico     1   TGTATTGGTGCCTCCGCCTTTCGACCATAAGTTTTATAGTCCTCAGTCGACAAATCCAAG 60


4821R-1.IR_full       61  CATTAATCGAAATCAATCTGCATCTGGTCCCAACTCCCAAGCGGCAATTAAAGAAGCTCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4821R-1.in silico     61  CATTAATCGAAATCAATCTGCATCTGGTCCCAACTCCCAAGCGGCAATTAAAGAAGCTCT 120


4821R-1.IR_full       121 TAAGCTTATGCTGCGTCCCTATTTCAATCACAGTGGGAATGCCCAAGAGCAACTTGCCCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
4821R-1.in silico     121 TAAGCTTATGCTGCGTCCCTATTTCAATCACAGTGGGAATGCCCAAGAGCAACTTGCTCA 180


4821R-1.IR_full       181 ACAGGCTGAATCGGCTATAGTGTCTGTGATTAGTAAAGGCGGTCAACCCACTACCACCCA 240
                          ||||||||||||||||||||||||||| ||||||||  || ||||| ||||||||| |||
4821R-1.in silico     181 ACAGGCTGAATCGGCTATAGTGTCTGTAATTAGTAA--GCCGTCAA-CCACTACCA-CCA 240


4821R-1.IR_full       241 CCACACCAAGGCCAACTTTCCAAGACACCTAAAACAGACCCNTGACTTTTGACGCCGAAC 300
                          |||||||||||||||| |||||||||||||||||||||||| |||| |||||||||||||
4821R-1.in silico     241 CCACACCAAGGCCAAC-TTCCAAGACACCTAAAACAGACCC-TGAC-TTTGACGCCGAAC 300


4821R-1.IR_full       301 TTATTAAAAGCGGGTGAACAGGAAAGCTTGGATTCCGTTGACGACGACTATGTTTTTCCA 360
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
4821R-1.in silico     301 TTATT-AAAGCGGGTGAACAGGAAAGCTTGGATTCCGTTGACGACGACTATGTTTTTCCA 360


4821R-1.IR_full       361 GATGCCAGGGAGACGTCCCGAACCGAGCAGACCCTAGATCCCAGTACCACATACGCCTCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4821R-1.in silico     361 GATGCCAGGGAGACGTCCCGAACCGAGCAGACCCTAGATCCCAGTACCACATACGCCTCG 420


4821R-1.IR_full       421 ACAAACTTTCAACGGAGCACTCGCAGGGCTGAGTTAGATCCTGACACCCTAACCGCAACT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4821R-1.in silico     421 ACAAACTTTCAACGGAGCACTCGCAGGGCTGAGTTAGATCCTGACACCCTAACCGCAACT 480


4821R-1.IR_full       481 ACAATGAAAACCAATTGGCATGCGCCTG 508
                          ||||||||||||||||||||||||||||
4821R-1.in silico     481 ACAATGAAAACCAATTGGCATGCGCCTG 508

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168314.1  CG4821-RD, transcript variant D (Tequila), mRNA 
100   482  NM_140031.1  CG4821-RA, transcript variant A (Tequila), mRNA 
100   482  NM_168316.1  CG4821-RB, transcript variant B (Tequila), mRNA 
0.41   16  NM_136593.1  CG8181-RA (CG8181), mRNA 
0   11  39  312  NM_170227.2  CG31439-RA (CG31439), mRNA 
0   NM_078879.2  CG10363-RA (TepIV), mRNA 
0   NM_057907.2  CG4007-RA (Nrk), mRNA 
0   NM_139408.1  CG12023-RA, transcript variant A (GV1), mRNA 
0   NM_130498.1  CG13362-RA (CG13362), mRNA 
0   12  NM_136423.1  CG11101-RA (pwn), mRNA 
0   NM_168120.1  CG10625-RB, transcript variant B (CG10625), mRNA 
0   NM_168119.1  CG10625-RD, transcript variant D (CG10625), mRNA 
0   NM_168121.1  CG10625-RC, transcript variant C (CG10625), mRNA 
0   NM_139713.2  CG10625-RA, transcript variant A (CG10625), mRNA 
0   NM_164582.1  CG3054-RA, transcript variant A (l(2)k05819), mRNA 
0   NM_134985.2  CG3054-RB, transcript variant B (l(2)k05819), mRNA 
0   NM_079496.2  CG14637-RA (abs), mRNA 
0   NM_135589.2  CG17104-RA (CG17104), mRNA 
0   NM_078517.2  CG2175-RA, transcript variant A (dec-1), mRNA 
0   18  NM_137883.1  CG13535-RA (CG13535), mRNA 
0   17  NM_142330.1  CG5225-RA (CG5225), mRNA 
0   12  NM_167438.1  CG9151-RB, transcript variant B (acj6), mRNA 
0   12  NM_001014744.1  CG9151-RC, transcript variant C (acj6), mRNA 
0   12  NM_080137.2  CG9151-RA, transcript variant A (acj6), mRNA 
0   12  NM_001014743.1  CG9151-RD, transcript variant D (acj6), mRNA 
0   15  NM_167212.1  CG32694-RB, transcript variant B (CG32694), mRNA 
0   NM_167193.1  CG32702-RA (CG32702), mRNA 
0   NM_130685.1  CG14420-RA (CG14420), mRNA 
0   NM_166259.1  CG30325-RA (CG30325), mRNA 
0   NM_132357.3  CG1468-RA (CG1468), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.