National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4813R-1 
 Symbol CG4813  Full Name CG4813 
 CG No CG4813  Old CG No CG4813 
 Synonyms CG4813 
 Accession No (Link to NCBI) NM_142831.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tang HW, Spirohn K, Hu Y, Hao T, Kovács IA, Gao Y, Binari R, Yang-Zhou D, Wan KH, Bader JS, Balcha D, Bian W, Booth BW, Coté AG, de Rouck S, Desbuleux A, Goh KY, Kim DK, Knapp JJ, Lee WX, Lemmens I, Li C, Li M, Li R, Lim HJ, Liu Y, Luck K, Markey D, Pollis C, Rangarajan S, Rodiger J, Schlabach S, Shen Y, Sheykhkarimli D, TeeKing B, Roth FP, Tavernier J, Calderwood MA, Hill DE, Celniker SE, Vidal M, Perrimon N, Mohr SE.
Next-generation large-scale binary protein interaction network for Drosophila melanogaster.
Nat Commun (2023) 14(1) 2162 [ PubMed ID = 37061542 ] [ RRC reference ]

Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS One (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGTGTGACCGTTTTCCACCGT 
 Primer Seq. 3'
aatctagaggtaccGACTGCGGAAAGTTGTGGTTG 
 Predicted Fragment Size
590 
 IR fragment full Seq
0001 AGTGTGACCG TTTTCCACCG TACGAGAACG TAAGAAATCG GCGTCGCGTG GCTTGGACAG 
0061 AGATTATCGA ACAAAACAAA ATCCGACTAC AGAATCTTTT AACTTCGTTT ACCCTTAAGA 
0121 GTCCGCGGTG GATCCGAGGA ATCGATGGCT ACGGACACGG TGTCCAACGG CGAGAACTTC 
0181 GCCCAGCACT TGAGCAGAAA CAGCGACGAC GACGTGATCT GTCCCACATG CGACGTGAAG 
0241 ATCAAGCGCA GTCAGGTGGC CGATCACTGC CAAGTGGAGG ATGCGAGCGC ATTGCACAAT 
0301 CCCATTAGCG CTGTCACTCC ACCGACCCCA ACTAGCGGAG CAACCGCGTC CCGAGGAATC 
0361 CGGTTCGGTA TCGGGGGGCA GACAACCGTG GAGCGTGTTC CAGCGGGTGC AGCGCAATCG 
0421 GCAGGCCCGT CAGCGCCAGC GCACCAGGAA GCGTCCGGCT TCTCCTGCCC CACCAGCAAC 
0481 TGTAAATCCT ACGGTAGCAG CTGCTCCTCC TCCAGCTGCA GCCAACTCCC GTCCGTAGCT 
0541 GCTGCCGAAT CGAGCCAACC CACCTGTCCC GTGTGCAACC ACAACTTTCC GCAGTC 
 in silico PCR Fragment
0001 AGTGTGACCG TTTTCCACCG TACGAGAACG TAAGAAATCG GCGTCGCGTG GCTTGGACAG 
0061 AGATTATCGA ACAAAACAAA ATCCGACTAC AGAATCTTTT AACTTCGTTT ACCCTTAAGA 
0121 GTCCGCGGTG GATCCGAGGA ATCGATGGCT ACGGACACGG TGTCCAACGG CGAGAACTTC 
0181 GCCCAGCACT TGAGCAGAAA CAGCGACGAC GACGTGATCT GTCCCACATG CGACGTGAAG 
0241 ATCAAGCGCA GTCAGGTGGC CGATCACTGC CAAGTGGA-G ATG-GAGCG- ATTGCACAAT 
0301 CCCATTAGCG CTGTCACTCC ACCGACCCCA ACTAGCGGAG CAACCGCGT- CCGAGGAATC 
0361 CGGTTCGGTA TCGGGGGGCA GACAACCGTG GAGCGTGTTC CAGCGGGTGC AGCGCAATCG 
0421 GCAGGCCCGT CAGCGCCAGC GCACCAGGAA GCGTCCGGCT TCTCCTGCCC CACCAGCAAC 
0481 TGTAAATCCT ACGGTAGCAG CTGCTCCTCC TCCAGCTGCA G-CAACT-CC GTCCGTAGCT 
0541 GCTGCCGAAT CGAGCCAACC CACCTGTCCC GTGTGCAACC ACAACTTTCC GCAGTC 
 Assemble Data

4813R-1.IR_full       1   AGTGTGACCGTTTTCCACCGTACGAGAACGTAAGAAATCGGCGTCGCGTGGCTTGGACAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4813R-1.in silico     1   AGTGTGACCGTTTTCCACCGTACGAGAACGTAAGAAATCGGCGTCGCGTGGCTTGGACAG 60


4813R-1.IR_full       61  AGATTATCGAACAAAACAAAATCCGACTACAGAATCTTTTAACTTCGTTTACCCTTAAGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4813R-1.in silico     61  AGATTATCGAACAAAACAAAATCCGACTACAGAATCTTTTAACTTCGTTTACCCTTAAGA 120


4813R-1.IR_full       121 GTCCGCGGTGGATCCGAGGAATCGATGGCTACGGACACGGTGTCCAACGGCGAGAACTTC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4813R-1.in silico     121 GTCCGCGGTGGATCCGAGGAATCGATGGCTACGGACACGGTGTCCAACGGCGAGAACTTC 180


4813R-1.IR_full       181 GCCCAGCACTTGAGCAGAAACAGCGACGACGACGTGATCTGTCCCACATGCGACGTGAAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4813R-1.in silico     181 GCCCAGCACTTGAGCAGAAACAGCGACGACGACGTGATCTGTCCCACATGCGACGTGAAG 240


4813R-1.IR_full       241 ATCAAGCGCAGTCAGGTGGCCGATCACTGCCAAGTGGAGGATGCGAGCGCATTGCACAAT 300
                          |||||||||||||||||||||||||||||||||||||| |||| ||||| ||||||||||
4813R-1.in silico     241 ATCAAGCGCAGTCAGGTGGCCGATCACTGCCAAGTGGA-GATG-GAGCG-ATTGCACAAT 300


4813R-1.IR_full       301 CCCATTAGCGCTGTCACTCCACCGACCCCAACTAGCGGAGCAACCGCGTCCCGAGGAATC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
4813R-1.in silico     301 CCCATTAGCGCTGTCACTCCACCGACCCCAACTAGCGGAGCAACCGCGT-CCGAGGAATC 360


4813R-1.IR_full       361 CGGTTCGGTATCGGGGGGCAGACAACCGTGGAGCGTGTTCCAGCGGGTGCAGCGCAATCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4813R-1.in silico     361 CGGTTCGGTATCGGGGGGCAGACAACCGTGGAGCGTGTTCCAGCGGGTGCAGCGCAATCG 420


4813R-1.IR_full       421 GCAGGCCCGTCAGCGCCAGCGCACCAGGAAGCGTCCGGCTTCTCCTGCCCCACCAGCAAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4813R-1.in silico     421 GCAGGCCCGTCAGCGCCAGCGCACCAGGAAGCGTCCGGCTTCTCCTGCCCCACCAGCAAC 480


4813R-1.IR_full       481 TGTAAATCCTACGGTAGCAGCTGCTCCTCCTCCAGCTGCAGCCAACTCCCGTCCGTAGCT 540
                          ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||
4813R-1.in silico     481 TGTAAATCCTACGGTAGCAGCTGCTCCTCCTCCAGCTGCAG-CAACT-CCGTCCGTAGCT 540


4813R-1.IR_full       541 GCTGCCGAATCGAGCCAACCCACCTGTCCCGTGTGCAACCACAACTTTCCGCAGTC 596
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4813R-1.in silico     541 GCTGCCGAATCGAGCCAACCCACCTGTCCCGTGTGCAACCACAACTTTCCGCAGTC 596

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   572  NM_142831.2  CG4813-RA (CG4813), mRNA 
0.17   15  NM_164375.1  CG18497-RC, transcript variant C (spen), mRNA 
0.17   15  NM_164374.1  CG18497-RA, transcript variant A (spen), mRNA 
0.17   15  NM_079979.2  CG18497-RB, transcript variant B (spen), mRNA 
0.17   NM_165214.1  CG5020-RC, transcript variant C (CLIP-190), mRNA 
0.17   NM_176058.1  CG5020-RD, transcript variant D (CLIP-190), mRNA 
0.17   NM_135991.2  CG5020-RA, transcript variant A (CLIP-190), mRNA 
0.17   NM_165213.2  CG5020-RB, transcript variant B (CLIP-190), mRNA 
0.17   NM_164449.1  CG4244-RC, transcript variant C (Su(dx)), mRNA 
0.17   NM_164448.1  CG4244-RA, transcript variant A (Su(dx)), mRNA 
0.17   NM_057405.2  CG4244-RB, transcript variant B (Su(dx)), mRNA 
0   NM_166059.1  CG30076-RA (CG30076), mRNA 
0   10  NM_144119.2  CG33466-RA (Fs), mRNA 
0   10  20  NM_080317.2  CG2647-RA (per), mRNA 
0   NM_078976.3  CG9015-RA, transcript variant A (en), mRNA 
0   NM_165841.1  CG9015-RB, transcript variant B (en), mRNA 
0   NM_135363.2  CG7806-RA (CG7806), mRNA 
0   NM_079206.2  CG7503-RA (Con), mRNA 
0   NM_139511.2  CG1869-RA (CG1869), mRNA 
0   NM_142210.1  CG6118-RA (CG6118), mRNA 
0   NM_170528.2  CG31012-RD, transcript variant D (CG31012), mRNA 
0   NM_170526.2  CG31012-RC, transcript variant C (CG31012), mRNA 
0   NM_135651.2  CG4751-RA (CG4751), mRNA 
0   NM_132007.2  CG3208-RB, transcript variant B (RhoGAP5A), mRNA 
0   NM_167040.2  CG3208-RA, transcript variant A (RhoGAP5A), mRNA 
0   NM_139676.1  CG13708-RA (CG13708), mRNA 
0   NM_206580.1  CG2304-RD, transcript variant D (Trc8), mRNA 
0   NM_170413.2  CG2304-RA, transcript variant A (Trc8), mRNA 
0   NM_170414.1  CG2304-RB, transcript variant B (Trc8), mRNA 
0   NM_079608.2  CG6148-RB, transcript variant B (Past1), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.