National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4807R-2 
 Symbol ab  Full Name abrupt 
 CG No CG4807  Old CG No CG4807 
 Synonyms CG4807, clu, ptd, l(2)k02807, ab 
 Accession No (Link to NCBI) NM_057214.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Ravisankar P, Lai YT, Sambrani N, Tomoyasu Y.
Comparative developmental analysis of Drosophila and Tribolium reveals conserved and diverged roles of abrupt in insect wing evolution.
Dev. Biol. (2015) [ PubMed ID = 26687509 ] [ RRC reference ]

Doggett K, Turkel N, Willoughby LF, Ellul J, Murray MJ, Richardson HE, Brumby AM.
BTB-Zinc Finger Oncogenes Are Required for Ras and Notch-Driven Tumorigenesis in Drosophila.
PLoS ONE (2015) 10(7) e0132987 [ PubMed ID = 26207831 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCTGCAGACGGCGGAGAACAACAACGCGGGCGTGGTCAAAATGGAGCCCCCGCCGCCGGC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GACCTCCTCCGTTTCCGTATCCGCCGCCGCAGCCGCCCACGCCCTCTCCTCCCTCTCTTC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCTTACAATGGCCGCCACCGGATCCGCCCTCTCGCCGGCCACGCCCCCGCCCTCCCTGAA 180

                          |||||||||||||||||||||||||||||| |||| ||||||||||||||| |||||||| silico     181 CCTCTCACATCAGCAGCAGCAGCACCAGCA-GCAC-TACGCCCTCAAGTGG-AATGACTT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCAGAGCTCGATCCTCAGCTCCTTCCGTCACCTGCGGGACGAGGAGGATTTCGTCGACGT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || silico     301 GACGCTGGCCTGCGACGAGCGTTCCTTCACCGCCCACAAGGTCGTCCTGA-GCGCCTGCA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCCCCTACTTCCGCCGGCTGCTCAAGGCCAATCCCTGCGAGCACCCGATAGTCATCCTGC 420

                           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| silico      421 CGACGTGCGCTGCGATGATGTCGAGAATCTGCTGAGCTTTATGTACAATGGTGAGGTGA 479

4807R-2.IR_full       481 ATGTGAGCCACGAACAGTTGCCCG 503
                          |||||||||||||||||||||||| silico     481 ATGTGAGCCACGAACAGTTGCCCG 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  12  67  NM_057214.3  CG4807-RA, transcript variant A (ab), mRNA 
100   482  12  67  NM_057215.3  CG4807-RB, transcript variant B (ab), mRNA 
1.86   36  104  NM_143623.1  CG1804-RA (kek6), mRNA 
1.86   28  NM_079832.2  CG7887-RA (Takr99D), mRNA 
1.45   75  197  NM_001038740.1  CG32776-RD, transcript variant D (CG32776), mRNA 
1.45   75  197  NM_206622.2  CG32776-RB, transcript variant B (CG32776), mRNA 
1.45   39  137  NM_166996.2  CG32776-RA, transcript variant A (CG32776), mRNA 
1.45   39  137  NM_001038741.1  CG32776-RC, transcript variant C (CG32776), mRNA 
1.24   20  48  71  NM_176582.1  CG14509-RA (CG14509), mRNA 
1.24   18  48  NM_136636.3  CG13739-RA (CG13739), mRNA 
1.03   25  123  255  NM_057771.2  CG1864-RB, transcript variant B (Hr38), mRNA 
1.03   11  53  159  NM_142259.2  CG10278-RA (GATAe), mRNA 
1.03   56  188  NM_079471.2  CG18023-RA, transcript variant A (Eip78C), mRNA 
1.03   56  188  NM_168892.1  CG18023-RB, transcript variant B (Eip78C), mRNA 
0.82   19  124  239  NM_137212.2  CG30089-RA (CG30089), mRNA 
0.82   26  NM_142845.1  CG13840-RA (CG13840), mRNA 
0.62   16  45  54  NM_132636.2  CG12723-RA (CG12723), mRNA 
0.62   10  25  47  NM_057982.3  CG2819-RA (Pph13), mRNA 
0.62   10  12  29  NM_136982.2  CG3850-RA (sug), mRNA 
0.62   27  NM_165367.1  CG18362-RA, transcript variant A (Mio), mRNA 
0.62   27  NM_136261.2  CG18362-RB, transcript variant B (Mio), mRNA 
0.62   27  NM_165366.1  CG18362-RC, transcript variant C (Mio), mRNA 
0.62   18  NM_165368.1  CG18362-RE, transcript variant E (Mio), mRNA 
0.62   18  NM_165369.1  CG18362-RD, transcript variant D (Mio), mRNA 
0.41   65  271  609  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
0.41   65  271  609  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
0.41   52  158  353  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
0.41   47  139  283  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
0.41   25  62  110  NM_001032400.1  CG9850-RB, transcript variant B (CG9850), mRNA 
0.41   24  97  202  NM_132027.2  CG15772-RA (CG15772), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.