National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4807R-2 
 Symbol ab  Full Name abrupt 
 CG No CG4807  Old CG No CG4807 
 Synonyms CG4807, clu, ptd, l(2)k02807, ab 
 Accession No (Link to NCBI) NM_057214.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Ravisankar P, Lai YT, Sambrani N, Tomoyasu Y.
Comparative developmental analysis of Drosophila and Tribolium reveals conserved and diverged roles of abrupt in insect wing evolution.
Dev. Biol. (2015) 409(2) 518-29 [ PubMed ID = 26687509 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Doggett K, Turkel N, Willoughby LF, Ellul J, Murray MJ, Richardson HE, Brumby AM.
BTB-Zinc Finger Oncogenes Are Required for Ras and Notch-Driven Tumorigenesis in Drosophila.
PLoS ONE (2015) 10(7) e0132987 [ PubMed ID = 26207831 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCTGCAGACGGCGGAGAACAACAACGCGGGCGTGGTCAAAATGGAGCCCCCGCCGCCGGC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GACCTCCTCCGTTTCCGTATCCGCCGCCGCAGCCGCCCACGCCCTCTCCTCCCTCTCTTC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCTTACAATGGCCGCCACCGGATCCGCCCTCTCGCCGGCCACGCCCCCGCCCTCCCTGAA 180

                          |||||||||||||||||||||||||||||| |||| ||||||||||||||| |||||||| silico     181 CCTCTCACATCAGCAGCAGCAGCACCAGCA-GCAC-TACGCCCTCAAGTGG-AATGACTT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCAGAGCTCGATCCTCAGCTCCTTCCGTCACCTGCGGGACGAGGAGGATTTCGTCGACGT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || silico     301 GACGCTGGCCTGCGACGAGCGTTCCTTCACCGCCCACAAGGTCGTCCTGA-GCGCCTGCA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCCCCTACTTCCGCCGGCTGCTCAAGGCCAATCCCTGCGAGCACCCGATAGTCATCCTGC 420

                           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| silico      421 CGACGTGCGCTGCGATGATGTCGAGAATCTGCTGAGCTTTATGTACAATGGTGAGGTGA 479

4807R-2.IR_full       481 ATGTGAGCCACGAACAGTTGCCCG 503
                          |||||||||||||||||||||||| silico     481 ATGTGAGCCACGAACAGTTGCCCG 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  12  67  NM_057214.3  CG4807-RA, transcript variant A (ab), mRNA 
100   482  12  67  NM_057215.3  CG4807-RB, transcript variant B (ab), mRNA 
1.86   36  104  NM_143623.1  CG1804-RA (kek6), mRNA 
1.86   28  NM_079832.2  CG7887-RA (Takr99D), mRNA 
1.45   75  197  NM_001038740.1  CG32776-RD, transcript variant D (CG32776), mRNA 
1.45   75  197  NM_206622.2  CG32776-RB, transcript variant B (CG32776), mRNA 
1.45   39  137  NM_166996.2  CG32776-RA, transcript variant A (CG32776), mRNA 
1.45   39  137  NM_001038741.1  CG32776-RC, transcript variant C (CG32776), mRNA 
1.24   20  48  71  NM_176582.1  CG14509-RA (CG14509), mRNA 
1.24   18  48  NM_136636.3  CG13739-RA (CG13739), mRNA 
1.03   25  123  255  NM_057771.2  CG1864-RB, transcript variant B (Hr38), mRNA 
1.03   11  53  159  NM_142259.2  CG10278-RA (GATAe), mRNA 
1.03   56  188  NM_079471.2  CG18023-RA, transcript variant A (Eip78C), mRNA 
1.03   56  188  NM_168892.1  CG18023-RB, transcript variant B (Eip78C), mRNA 
0.82   19  124  239  NM_137212.2  CG30089-RA (CG30089), mRNA 
0.82   26  NM_142845.1  CG13840-RA (CG13840), mRNA 
0.62   16  45  54  NM_132636.2  CG12723-RA (CG12723), mRNA 
0.62   10  25  47  NM_057982.3  CG2819-RA (Pph13), mRNA 
0.62   10  12  29  NM_136982.2  CG3850-RA (sug), mRNA 
0.62   27  NM_165367.1  CG18362-RA, transcript variant A (Mio), mRNA 
0.62   27  NM_136261.2  CG18362-RB, transcript variant B (Mio), mRNA 
0.62   27  NM_165366.1  CG18362-RC, transcript variant C (Mio), mRNA 
0.62   18  NM_165368.1  CG18362-RE, transcript variant E (Mio), mRNA 
0.62   18  NM_165369.1  CG18362-RD, transcript variant D (Mio), mRNA 
0.41   65  271  609  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
0.41   65  271  609  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
0.41   52  158  353  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
0.41   47  139  283  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
0.41   25  62  110  NM_001032400.1  CG9850-RB, transcript variant B (CG9850), mRNA 
0.41   24  97  202  NM_132027.2  CG15772-RA (CG15772), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.