National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4719R-4 
 Symbol tankyrase  Full Name tankyrase 
 CG No CG4719  Old CG No CG4719 
 Synonyms BcDNA:LD22548, unnamed, CG17487, CG4719, tankyrase 
 Accession No (Link to NCBI) NM_143153.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Li P, Huang P, Li X, Yin D, Ma Z, Wang H, Song H.
Tankyrase Mediates K63-Linked Ubiquitination of JNK to Confer Stress Tolerance and Influence Lifespan in Drosophila.
Cell Rep (2018) 25(2) 437-448 [ PubMed ID = 30304683 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGCCAAGGTGAAGAAGCTAA 
 Primer Seq. 3'
aatctagaggtaccGTTGACATTGAGTGGCGTGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCGCCAAGGT GAAGAAGCTA ATAACGCCTC AGACCGTGAA CGCCAGGGAT ACGGCGGGAC 
0061 gNANATCCAC ACCATTGCAT TTCGCAGCGG GTTATGGACG CCGGGAAGTG GTTGAATTCC 
0121 TGCTGAACAG CGGCGCCTCC ATACAGGCGT GTGACGAGGG TGGGCTGCAC CCGCNTGCAC 
0181 AACTGTTGCT CCTTTGGCCA CGCCGAGGTA GTTCGATTGT TGCTGAAGGC AGGTGCCAGT 
0241 CCAAACACCA CCGACAACTG GAACTACACG CCATTGCACG AGGCGGCCAG CAAGGGCAAG 
0301 GTGGATGTGT GCCTGGCTCT GTTGCAGCAT GGCGCAAACC ATACGATCCG CAACTCGGAG 
0361 CAGAAGACAC CACTGGAGCT GGCGGACGAG GCGACGCGTC CCGTATTGAC CGGCGAATAT 
0421 CGAAAGGATG AGCTGCTTGA AGCCGCNACG CTCGGGGGCC GAGGATCGCC TGCTGGCCCT 
0481 ACTCACGCCA CTCAATGTCA AAC 
 in silico PCR Fragment
0001 TCGCCAAGGT GAAGAAGCTA ATAACGCCTC AGACCGTGAA CGCCAGGGAT ACGGCGGGAC 
0061 GCAAATCCAC ACCATTGCAT TTCGCAGCGG GTTATGGACG CCGGGAAGTG GTTGAATTCC 
0121 TGCTGAACAG CGGCGCCTCC ATACAGGCGT GTGACGAGGG TGGGCTGCAC CCGC-TGCAC 
0181 AACTGTTGCT CCTTTGGCCA CGCCGAGGTA GTTCGATTGT TGCTGAAGGC AGGTGCCAGT 
0241 CCAAACACCA CCGACAACTG GAACTACACG CCATTGCACG AGGCGGCCAG CAAGGGCAAG 
0301 GTGGATGTGT GCCTGGCTCT GTTGCAGCAT GGCGCAAACC ATACGATCCG CAACTCGGAG 
0361 CAGAAGACAC CACTGGAGCT GGCGGACGAG GCGACGCGTC CCGTATTGAC CGGCGAATAT 
0421 CGAAAGGATG AGCTGCTTGA AGCCGC-ACG CTCGGGGGCC GAGGATCGCC TGCTGGCCCT 
0481 ACTCACGCCA CTCAATGTC- AAC 
 Assemble Data

4719R-4.IR_full       1   TCGCCAAGGTGAAGAAGCTAATAACGCCTCAGACCGTGAACGCCAGGGATACGGCGGGAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4719R-4.in silico     1   TCGCCAAGGTGAAGAAGCTAATAACGCCTCAGACCGTGAACGCCAGGGATACGGCGGGAC 60


4719R-4.IR_full       61  GNANATCCACACCATTGCATTTCGCAGCGGGTTATGGACGCCGGGAAGTGGTTGAATTCC 120
                          | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4719R-4.in silico     61  GCAAATCCACACCATTGCATTTCGCAGCGGGTTATGGACGCCGGGAAGTGGTTGAATTCC 120


4719R-4.IR_full       121 TGCTGAACAGCGGCGCCTCCATACAGGCGTGTGACGAGGGTGGGCTGCACCCGCNTGCAC 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
4719R-4.in silico     121 TGCTGAACAGCGGCGCCTCCATACAGGCGTGTGACGAGGGTGGGCTGCACCCGC-TGCAC 180


4719R-4.IR_full       181 AACTGTTGCTCCTTTGGCCACGCCGAGGTAGTTCGATTGTTGCTGAAGGCAGGTGCCAGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4719R-4.in silico     181 AACTGTTGCTCCTTTGGCCACGCCGAGGTAGTTCGATTGTTGCTGAAGGCAGGTGCCAGT 240


4719R-4.IR_full       241 CCAAACACCACCGACAACTGGAACTACACGCCATTGCACGAGGCGGCCAGCAAGGGCAAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4719R-4.in silico     241 CCAAACACCACCGACAACTGGAACTACACGCCATTGCACGAGGCGGCCAGCAAGGGCAAG 300


4719R-4.IR_full       301 GTGGATGTGTGCCTGGCTCTGTTGCAGCATGGCGCAAACCATACGATCCGCAACTCGGAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4719R-4.in silico     301 GTGGATGTGTGCCTGGCTCTGTTGCAGCATGGCGCAAACCATACGATCCGCAACTCGGAG 360


4719R-4.IR_full       361 CAGAAGACACCACTGGAGCTGGCGGACGAGGCGACGCGTCCCGTATTGACCGGCGAATAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4719R-4.in silico     361 CAGAAGACACCACTGGAGCTGGCGGACGAGGCGACGCGTCCCGTATTGACCGGCGAATAT 420


4719R-4.IR_full       421 CGAAAGGATGAGCTGCTTGAAGCCGCNACGCTCGGGGGCCGAGGATCGCCTGCTGGCCCT 480
                          |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
4719R-4.in silico     421 CGAAAGGATGAGCTGCTTGAAGCCGC-ACGCTCGGGGGCCGAGGATCGCCTGCTGGCCCT 480


4719R-4.IR_full       481 ACTCACGCCACTCAATGTCAAAC 503
                          ||||||||||||||||||| |||
4719R-4.in silico     481 ACTCACGCCACTCAATGTC-AAC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143153.2  CG4719-RA (tankyrase), mRNA 
0   NM_078841.3  CG4215-RA, transcript variant A (spel1), mRNA 
0   NM_001014482.1  CG4215-RC, transcript variant C (spel1), mRNA 
0   NM_058144.2  CG11420-RA (png), mRNA 
0   NM_141252.2  CG1124-RA (CG1124), mRNA 
0   NM_142499.1  CG14297-RA (CG14297), mRNA 
0   NM_139551.1  CG14961-RA (CG14961), mRNA 
0   NM_001038934.2  CG33989-RD, transcript variant D (pHCl), mRNA 
0   NM_001038937.1  CG33989-RC, transcript variant C (pHCl), mRNA 
0   NM_001038935.2  CG33989-RF, transcript variant F (pHCl), mRNA 
0   NM_001038936.2  CG33989-RE, transcript variant E (pHCl), mRNA 
0   NM_135891.3  CG4140-RA (CG4140), mRNA 
0   NM_079078.2  CG9707-RA (Acox57D-p), mRNA 
0   NM_136028.2  CG7180-RA (CG7180), mRNA 
0   NM_078679.2  CG6816-RB, transcript variant B (Cyp18a1), mRNA 
0   NM_167628.1  CG6816-RA, transcript variant A (Cyp18a1), mRNA 
0   NM_144143.2  CG14767-RA, transcript variant A (CG14767), mRNA 
0   NM_165620.1  CG14767-RC, transcript variant C (CG14767), mRNA 
0   NM_165619.1  CG14767-RB, transcript variant B (CG14767), mRNA 
0   NM_144343.2  CG8250-RA (Alk), mRNA 
0   NM_138191.2  CG13884-RA (CG13884), mRNA 
0   NM_136168.1  CG10662-RA (sick), mRNA 
0   NM_058083.2  CG14941-RA (esc), mRNA 
0   NM_138186.1  CG17061-RA, transcript variant A (mthl10), mRNA 
0   11  NM_001042833.1  CG41480-RA (CG41480), mRNA 
0   NM_167961.1  CG1244-RE, transcript variant E (CG1244), mRNA 
0   NM_167962.1  CG1244-RF, transcript variant F (CG1244), mRNA 
0   NM_167960.1  CG1244-RD, transcript variant D (CG1244), mRNA 
0   NM_167958.1  CG1244-RB, transcript variant B (CG1244), mRNA 
0   NM_139476.1  CG1244-RA, transcript variant A (CG1244), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.