National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4707R-1 
 Symbol CG4707  Full Name CG4707 
 CG No CG4707  Old CG No CG4707 
 Synonyms CG4707 
 Accession No (Link to NCBI) NM_138100.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Lindström R, Lindholm P, Palgi M, Saarma M, Heino TI.
In vivo screening reveals interactions between Drosophila Manf and genes involved in the mitochondria and the ubiquinone synthesis pathway.
BMC Genet. (2017) 18(1) 52 [ PubMed ID = 28578657 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCTGGACAGTAGCAATGCTGG 
 Primer Seq. 3'
aatctagaggtaccGAGGTGCATCCGAGTCACTAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCTGGNACAG TAGCAATGCT GGCTACGGCC TACAATCCGA GGAAGGCGTC CGTCTGAACA 
0061 TTAGGGCGAC CATCCACAAN GCACTTCGCG TTCTCCGAGG TTCTTACGGC TGGCGGTGAT 
0121 GCTGAGGTCT GTCGGGAGTG CTGGAACTGC GTTAGCAGCT TCGAGGAGTT TCACCAGCGC 
0181 GTCTCCTGCC TGCACCGGCA GCGGAGCAGC GNATTCCAAA AGCGAACCCA TCGAATTTTG 
0241 CGGTCAGACA GAGGAGGCCA TCATTAATCC GCTATATTCT GTGGAGTTGG ACGCGTTGGC 
0301 GGAGGCNCTT TTTTGCGCCC AGTGAGGTCA AGGTGGAGGT GAACGAACTA GAACCCCTGC 
0361 CCAAGGTGGA ACTCTTGGAA GACCCAGTTA AAACGGAAAT CAGAACAGCT CCGAAACGGT 
0421 TGGGTGTCCC AAACGAAGGC TCACCACACT CGAAGCGGCG CATTAAAAAC GAGCTGCCAG 
0481 TGGATAGTGA CTCGGATGCA CCTC 
 in silico PCR Fragment
0001 CCTGG-ACAG TAGCAATGCT GGCTACGGCC TACAATCCGA GGAAGGCGTC CGTCTGAACA 
0061 TTAGGGCGAC CATCCACAA- GCACTTCGCG TTCTCCGAGG TTCTTACGGC TGGCGGTGAT 
0121 GCTGAGGTCT GTCGGGAGTG CTGGAACTGC GTTAGCAGCT TCGAGGAGTT TCACCAGCGC 
0181 GTCTCCTGCC TGCACCGGCA GCGGAGCAGC G-ATTCCAAA AGCGAACCCA TCGAATTTTG 
0241 CGGTCAGACA GAGGAGGCCA TCATTAATCC GCTATATTCT GTGGAGTTGG ACGCGTTGGC 
0301 GGAGGC-CTT TTTTGCGCCC AGTGAGGTCA AGGTGGAGGT GAACGAACTA GAACCCCTGC 
0361 CCAAGGTGGA ACTCTTGGAA GACCCAGTTA AAACGGAAAT CAGAACAGCT CCGAAACGGT 
0421 TGGGTGTCCC AAACGAAGGC TCACCACACT CGAAGCGGCG CATTAAAAAC GAGCTGCCAG 
0481 TGGATAGTGA CTCGGATGCA CCTC 
 Assemble Data

4707R-1.IR_full       1   CCTGGNACAGTAGCAATGCTGGCTACGGCCTACAATCCGAGGAAGGCGTCCGTCTGAACA 60
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
4707R-1.in silico     1   CCTGG-ACAGTAGCAATGCTGGCTACGGCCTACAATCCGAGGAAGGCGTCCGTCTGAACA 60


4707R-1.IR_full       61  TTAGGGCGACCATCCACAANGCACTTCGCGTTCTCCGAGGTTCTTACGGCTGGCGGTGAT 120
                          ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
4707R-1.in silico     61  TTAGGGCGACCATCCACAA-GCACTTCGCGTTCTCCGAGGTTCTTACGGCTGGCGGTGAT 120


4707R-1.IR_full       121 GCTGAGGTCTGTCGGGAGTGCTGGAACTGCGTTAGCAGCTTCGAGGAGTTTCACCAGCGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4707R-1.in silico     121 GCTGAGGTCTGTCGGGAGTGCTGGAACTGCGTTAGCAGCTTCGAGGAGTTTCACCAGCGC 180


4707R-1.IR_full       181 GTCTCCTGCCTGCACCGGCAGCGGAGCAGCGNATTCCAAAAGCGAACCCATCGAATTTTG 240
                          ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
4707R-1.in silico     181 GTCTCCTGCCTGCACCGGCAGCGGAGCAGCG-ATTCCAAAAGCGAACCCATCGAATTTTG 240


4707R-1.IR_full       241 CGGTCAGACAGAGGAGGCCATCATTAATCCGCTATATTCTGTGGAGTTGGACGCGTTGGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4707R-1.in silico     241 CGGTCAGACAGAGGAGGCCATCATTAATCCGCTATATTCTGTGGAGTTGGACGCGTTGGC 300


4707R-1.IR_full       301 GGAGGCNCTTTTTTGCGCCCAGTGAGGTCAAGGTGGAGGTGAACGAACTAGAACCCCTGC 360
                          |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
4707R-1.in silico     301 GGAGGC-CTTTTTTGCGCCCAGTGAGGTCAAGGTGGAGGTGAACGAACTAGAACCCCTGC 360


4707R-1.IR_full       361 CCAAGGTGGAACTCTTGGAAGACCCAGTTAAAACGGAAATCAGAACAGCTCCGAAACGGT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4707R-1.in silico     361 CCAAGGTGGAACTCTTGGAAGACCCAGTTAAAACGGAAATCAGAACAGCTCCGAAACGGT 420


4707R-1.IR_full       421 TGGGTGTCCCAAACGAAGGCTCACCACACTCGAAGCGGCGCATTAAAAACGAGCTGCCAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4707R-1.in silico     421 TGGGTGTCCCAAACGAAGGCTCACCACACTCGAAGCGGCGCATTAAAAACGAGCTGCCAG 480


4707R-1.IR_full       481 TGGATAGTGACTCGGATGCACCTC 504
                          ||||||||||||||||||||||||
4707R-1.in silico     481 TGGATAGTGACTCGGATGCACCTC 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138100.2  CG4707-RA (CG4707), mRNA 
0.2   NM_079502.2  CG1059-RA (Karybeta3), mRNA 
0   NM_001014716.1  CG33513-RA, transcript variant A (Nmdar2), mRNA 
0   NM_001014714.1  CG33513-RC, transcript variant C (Nmdar2), mRNA 
0   NM_001014715.1  CG33513-RB, transcript variant B (Nmdar2), mRNA 
0   NM_138012.2  CG2980-RA (thoc5), mRNA 
0   NM_143744.2  CG5553-RA (DNAprim), mRNA 
0   NM_143642.1  CG2112-RA (CG2112), mRNA 
0   NM_135647.2  CG14921-RA (CG14921), mRNA 
0   NM_132014.2  CG4119-RA (CG4119), mRNA 
0   NM_139493.2  CG2083-RA (CG2083), mRNA 
0   NM_143399.1  CG11833-RA (Ssl2), mRNA 
0   NM_141661.1  CG8312-RA, transcript variant A (CG8312), mRNA 
0   NM_176438.1  CG8312-RB, transcript variant B (CG8312), mRNA 
0   NM_132432.1  CG2186-RA (CG2186), mRNA 
0   NM_079657.2  CG14904-RA (Scp2), mRNA 
0   NM_135849.2  CG8942-RA (CG8942), mRNA 
0   NM_140709.1  CG13724-RA (CG13724), mRNA 
0   NM_143303.1  CG6599-RA (CG6599), mRNA 
0   NM_176039.1  CG32970-RA (CG32970), mRNA 
0   NM_134485.3  CG12788-RA, transcript variant A (CG12788), mRNA 
0   NM_001031903.1  CG17767-RC, transcript variant C (Tim9b), mRNA 
0   10  NM_136154.1  CG10631-RA (CG10631), mRNA 
0   NM_136816.1  CG13214-RA, transcript variant A (CG13214), mRNA 
0   NM_168254.1  CG7915-RB, transcript variant B (Ect4), mRNA 
0   NM_001043129.1  CG7915-RC, transcript variant C (Ect4), mRNA 
0   NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_140314.2  CG10698-RA (GRHRII), mRNA 
0   NM_141594.1  CG11970-RA (CG11970), mRNA 
0   NM_057502.2  CG1322-RB, transcript variant B (zfh1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.