National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4696R-4 
 Symbol Mp20  Full Name Muscle protein 20 
 CG No CG4696  Old CG No CG4696 
 Synonyms DMMP20, Dmmp20, CG4696, mp20, Tpn, Mp20 
 Accession No (Link to NCBI) NM_057295.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Junion G, Bataillé L, Jagla T, Da Ponte JP, Tapin R, Jagla K.
Genome-wide view of cell fate specification: ladybird acts at multiple levels during diversification of muscle and heart precursors.
Genes Dev. (2007) 21(23) 3163-80 [ PubMed ID = 18056427 ] [ RRC reference ]

Perkins AD, Lee MJ, Tanentzapf G.
The systematic identification of cytoskeletal genes required for Drosophila melanogaster muscle maintenance.
Sci Data (2014) 1 140002 [ PubMed ID = 25977760 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATGGACAAGGAGGCCCAGGA 
 Primer Seq. 3'
aatctagaggtaccCTTGCCGAGCAGGATCTTGCG 
 Predicted Fragment Size
499 
 IR fragment full Seq
0001 NATGGACAAG GAGGCCCAGG AGTGGATCGA GGCCATCATT GCCGAGAAGT TCCCCGCCGG 
0061 CCAGTCCTAC GAGGATGTGC TCAAGGACGG TCAGGTGCTG TGCAAACTGA TCAANCGTGC 
0121 TGTCGCCCAA TGCCGTGCCC AAGGTCAACT CCTCGGGCGG CCAGTTCAAG TTCATGGAGA 
0181 ACATCAACAA CTTCCAGAAG GCCCTGAAGG AGTACGGTGT GCCCGACATC GATGTCTTCC 
0241 AGACCGTCGA TCTGTACGAG AAGAAGGATA TTGCCAACGT TACCAACACC ATCTTCGCTT 
0301 TGGGCCGTGC CACCTACAAG CATGCCGACT TCAAGGGTCC CTTCCTGGGC CCCAAGCCCG 
0361 CCGATGAGTG CAAGCGCGAC TTCACCGAAG AGCAGCTGAA GGCTGGCCAG ACCATTGTGG 
0421 GTCTGCAGGC CGGTTCCAAC AAGGGAGCCA CCCAGGCTGG CCAGAACCTC GGCGCTGGCC 
0481 GCAAGATCCT GCTCGGCAAG  
 in silico PCR Fragment
0001 GATGGACAAG GAGGCCCAGG AGTGGATCGA GGCCATCATT GCCGAGAAGT TCCCCGCCGG 
0061 CCAGTCCTAC GAGGATGTGC TCAAGGACGG TCAGGTGCTG TGCAAACTGA TCAA-CGTGC 
0121 TGTCGCCCAA TGCCGTGCCC AAGGTCAACT CCTCGGGCGG CCAGTTCAAG TTCATGGAGA 
0181 ACATCAACAA CTTCCAGAAG GCCCTGAAGG AGTACGGTGT GCCCGACATC GATGTCTTCC 
0241 AGACCGTCGA TCTGTACGAG AAGAAGGATA TTGCCAACGT TACCAACACC ATCTTCGCTT 
0301 TGGGCCGTGC CACCTACAAG CATGCCGACT TCAAGGGTCC CTTCCTGGGC CCCAAGCCCG 
0361 CCGATGAGTG CAAGCGCGAT TTCACCGAAG AGCAGCTGAA GGCTGGCCAG ACCATTGTGG 
0421 GTCTGCAGGC CGGTTCCAAC AAGGGAGCCA CCCAGGCTGG CCAGAACCTC GGCGCTGGCC 
0481 GCAAGATCCT GCTCGGCAAG  
 Assemble Data

4696R-4.IR_full        1   ATGGACAAGGAGGCCCAGGAGTGGATCGAGGCCATCATTGCCGAGAAGTTCCCCGCCGG 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4696R-4.in silico      1   ATGGACAAGGAGGCCCAGGAGTGGATCGAGGCCATCATTGCCGAGAAGTTCCCCGCCGG 59


4696R-4.IR_full       61  CCAGTCCTACGAGGATGTGCTCAAGGACGGTCAGGTGCTGTGCAAACTGATCAANCGTGC 119
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
4696R-4.in silico     61  CCAGTCCTACGAGGATGTGCTCAAGGACGGTCAGGTGCTGTGCAAACTGATCAA-CGTGC 119


4696R-4.IR_full       121 TGTCGCCCAATGCCGTGCCCAAGGTCAACTCCTCGGGCGGCCAGTTCAAGTTCATGGAGA 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4696R-4.in silico     121 TGTCGCCCAATGCCGTGCCCAAGGTCAACTCCTCGGGCGGCCAGTTCAAGTTCATGGAGA 179


4696R-4.IR_full       181 ACATCAACAACTTCCAGAAGGCCCTGAAGGAGTACGGTGTGCCCGACATCGATGTCTTCC 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4696R-4.in silico     181 ACATCAACAACTTCCAGAAGGCCCTGAAGGAGTACGGTGTGCCCGACATCGATGTCTTCC 239


4696R-4.IR_full       241 AGACCGTCGATCTGTACGAGAAGAAGGATATTGCCAACGTTACCAACACCATCTTCGCTT 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4696R-4.in silico     241 AGACCGTCGATCTGTACGAGAAGAAGGATATTGCCAACGTTACCAACACCATCTTCGCTT 299


4696R-4.IR_full       301 TGGGCCGTGCCACCTACAAGCATGCCGACTTCAAGGGTCCCTTCCTGGGCCCCAAGCCCG 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4696R-4.in silico     301 TGGGCCGTGCCACCTACAAGCATGCCGACTTCAAGGGTCCCTTCCTGGGCCCCAAGCCCG 359


4696R-4.IR_full       361 CCGATGAGTGCAAGCGCGACTTCACCGAAGAGCAGCTGAAGGCTGGCCAGACCATTGTGG 419
                          ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
4696R-4.in silico     361 CCGATGAGTGCAAGCGCGATTTCACCGAAGAGCAGCTGAAGGCTGGCCAGACCATTGTGG 419


4696R-4.IR_full       421 GTCTGCAGGCCGGTTCCAACAAGGGAGCCACCCAGGCTGGCCAGAACCTCGGCGCTGGCC 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4696R-4.in silico     421 GTCTGCAGGCCGGTTCCAACAAGGGAGCCACCCAGGCTGGCCAGAACCTCGGCGCTGGCC 479


4696R-4.IR_full       481 GCAAGATCCTGCTCGGCAAG 499
                          ||||||||||||||||||||
4696R-4.in silico     481 GCAAGATCCTGCTCGGCAAG 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_057295.3  CG4696-RA, transcript variant A (Mp20), mRNA 
100   481  NM_001014522.1  CG4696-RB, transcript variant B (Mp20), mRNA 
0.2   NM_206717.2  CG9220-RC (CG9220), mRNA 
0.2   NM_165801.1  CG12323-RB, transcript variant B (Prosbeta5), mRNA 
0.2   NM_143757.3  CG12323-RA, transcript variant A (Prosbeta5), mRNA 
0   10  23  NM_139603.2  CG14996-RB (Chd64), mRNA 
0   NM_080011.2  CG7035-RB, transcript variant B (Cbp80), mRNA 
0   NM_167012.1  CG7035-RA, transcript variant A (Cbp80), mRNA 
0   NM_057357.2  CG1569-RA (rod), mRNA 
0   17  NM_078712.2  CG12794-RA (lcs), mRNA 
0   25  NM_142610.2  CG5023-RA (CG5023), mRNA 
0   NM_139844.2  CG8606-RA, transcript variant A (RhoGEF4), mRNA 
0   NM_168199.1  CG8606-RB, transcript variant B (RhoGEF4), mRNA 
0   NM_141341.2  CG1208-RA (CG1208), mRNA 
0   NM_058030.3  CG4581-RA (Thiolase), mRNA 
0   NM_137628.1  CG13868-RA (CG13868), mRNA 
0   NM_001043241.1  CG14713-RB (CG14713), mRNA 
0   NM_139356.1  CG3524-RA (v(2)k05816), mRNA 
0   NM_169701.2  CG31045-RB, transcript variant B (Mhcl), mRNA 
0   NM_169700.2  CG31045-RA, transcript variant A (Mhcl), mRNA 
0   NM_001043250.1  CG31045-RG, transcript variant G (Mhcl), mRNA 
0   NM_170650.3  CG31045-RC, transcript variant C (Mhcl), mRNA 
0   NM_001043251.1  CG31045-RF, transcript variant F (Mhcl), mRNA 
0   NM_136536.2  CG2110-RA (Cyp4ad1), mRNA 
0   NM_137199.2  CG8182-RA, transcript variant A (GalNAc-T1), mRNA 
0   NM_166099.1  CG8182-RB, transcript variant B (GalNAc-T1), mRNA 
0   NM_135559.2  CG5337-RA (CG5337), mRNA 
0   NM_001043040.1  CG17800-PAJ (Dscam), mRNA 
0   NM_080107.1  CG15191-RA (e(y)2), mRNA 
0   NM_001042789.1  CG13366-RB, transcript variant B (CG13366), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.