National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4650R-1 
 Symbol CG4650  Full Name CG4650 
 CG No CG4650  Old CG No CG4650 
 Synonyms SPH197, CG4650 
 Accession No (Link to NCBI) NM_135878.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTATGTGTGCGGCGGAACTGTG 
 Primer Seq. 3'
aatctagaggtaccCCCAGAGGACTGCTAAAGTCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TATGTGTGcG GCGGAACTGT GATAACTGAA AgttcAATTA GTTCTGACTG CAGCgNATTG 
0061 CACAAGGGCC AGCGAACAAT TgcAGTAGCT CGAATTGGAG AGTTTATAGG AACGGATGAT 
0121 GCTAATGACA CGATGTTATC AGAGTACCAA GTAAGCCAAA CCTTTATACA TTCCTTATAC 
0181 AATACGACCA CAAGCGCCAA TGACATAGCT ATTGCTCGGC TTGGCTACGG ATNTTGTGTT 
0241 TTCGAAAACC ATTAGACCAA TTTGCATAGT GTGGTGGACC ATTTGGAGAA AATATATCGA 
0301 CAACATACAG GTGCTAANCG GTGCTCAATG GGGTCTACCC AATGATCGAA ATGAAAgCGA 
0361 TGCATTTAGA ATTACAGACA TCAGACGTCA ACCAGCAAAT ATGTGTTCTA CNCTAAACGG 
0421 CACTGCAATT TTGAGCAGTC AGTTTTGTGC TGGAGACTCG GATTCCAAAC TGTGCAATGT 
0481 TGACTTTAGC AGTNCTCTGG G 
 in silico PCR Fragment
0001 TATGTGTGCG GCGGAACTGT GATAACTGAA AGTTCAATTA GTTCTGACTG CAGCGCATTG 
0061 CACAAGGGCC AGCGAACAAT TGCACTAGCT CGAATTGGAG AGTTTATAGG AACGGATGAT 
0121 GCTAATGACA CGATGTTATC AGAGTACCAA GTAAGCCAAA CCTTTATACA TTCCTTATAC 
0181 AATACGACCA CAAGCGCCAA TGACATAGCT ATT-CTCGGC TTGGCTACGG ATATTGTGTT 
0241 TTCGAAAACC ATTAGACCAA TTTGCATAGT GTGGTGGACC ATTTGGAGAA AATATATCGA 
0301 CAACATACAG GTGCTAAGCG GTGCTCAATG GGGTCTACCC AATGATCGAA ATGAAAGCGA 
0361 TGCATTTAGA ATTACAGACA TCAGACGTCA ACCAGCAAAT ATGTGTTCTA CCCTAAACGG 
0421 CACTGCAATT TTGAGCAGTC AGTTTTGTGC TGGAGACTCG GATTCCAAAC TGTGCAATGT 
0481 TGACTTTAGC AGTCCTCTGG G 
 Assemble Data

4650R-1.IR_full       1   TATGTGTGCGGCGGAACTGTGATAACTGAAAGTTCAATTAGTTCTGACTGCAGCGNATTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
4650R-1.in silico     1   TATGTGTGCGGCGGAACTGTGATAACTGAAAGTTCAATTAGTTCTGACTGCAGCGCATTG 60


4650R-1.IR_full       61  CACAAGGGCCAGCGAACAATTGCAGTAGCTCGAATTGGAGAGTTTATAGGAACGGATGAT 120
                          |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
4650R-1.in silico     61  CACAAGGGCCAGCGAACAATTGCACTAGCTCGAATTGGAGAGTTTATAGGAACGGATGAT 120


4650R-1.IR_full       121 GCTAATGACACGATGTTATCAGAGTACCAAGTAAGCCAAACCTTTATACATTCCTTATAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4650R-1.in silico     121 GCTAATGACACGATGTTATCAGAGTACCAAGTAAGCCAAACCTTTATACATTCCTTATAC 180


4650R-1.IR_full       181 AATACGACCACAAGCGCCAATGACATAGCTATTGCTCGGCTTGGCTACGGATNTTGTGTT 240
                          ||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||
4650R-1.in silico     181 AATACGACCACAAGCGCCAATGACATAGCTATT-CTCGGCTTGGCTACGGATATTGTGTT 240


4650R-1.IR_full       241 TTCGAAAACCATTAGACCAATTTGCATAGTGTGGTGGACCATTTGGAGAAAATATATCGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4650R-1.in silico     241 TTCGAAAACCATTAGACCAATTTGCATAGTGTGGTGGACCATTTGGAGAAAATATATCGA 300


4650R-1.IR_full       301 CAACATACAGGTGCTAANCGGTGCTCAATGGGGTCTACCCAATGATCGAAATGAAAGCGA 360
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
4650R-1.in silico     301 CAACATACAGGTGCTAAGCGGTGCTCAATGGGGTCTACCCAATGATCGAAATGAAAGCGA 360


4650R-1.IR_full       361 TGCATTTAGAATTACAGACATCAGACGTCAACCAGCAAATATGTGTTCTACNCTAAACGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
4650R-1.in silico     361 TGCATTTAGAATTACAGACATCAGACGTCAACCAGCAAATATGTGTTCTACCCTAAACGG 420


4650R-1.IR_full       421 CACTGCAATTTTGAGCAGTCAGTTTTGTGCTGGAGACTCGGATTCCAAACTGTGCAATGT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4650R-1.in silico     421 CACTGCAATTTTGAGCAGTCAGTTTTGTGCTGGAGACTCGGATTCCAAACTGTGCAATGT 480


4650R-1.IR_full       481 TGACTTTAGCAGTNCTCTGGG 501
                          ||||||||||||| |||||||
4650R-1.in silico     481 TGACTTTAGCAGTCCTCTGGG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135878.1  CG4650-RA (CG4650), mRNA 
0   NR_002693.1  CR15280, mRNA 
0   10  NM_205993.1  CG18420-RA (CG18420), mRNA 
0   NM_135957.2  CG31738-RB, transcript variant B (CG31738), mRNA 
0   NM_165168.1  CG31738-RA, transcript variant A (CG31738), mRNA 
0   NM_167837.1  CG17129-RB, transcript variant B (CG17129), mRNA 
0   NM_138204.2  CG17129-RA, transcript variant A (CG17129), mRNA 
0   NM_167838.1  CG17129-RC, transcript variant C (CG17129), mRNA 
0   NM_058142.3  CG10033-RE, transcript variant E (for), mRNA 
0   NM_001014464.1  CG10033-RJ, transcript variant J (for), mRNA 
0   NM_137317.1  CG6301-RA (CG6301), mRNA 
0   NM_079533.2  CG1131-RA (alpha-Est10), mRNA 
0   NM_165325.1  CG10076-RC, transcript variant C (spir), mRNA 
0   NM_080115.2  CG10076-RB, transcript variant B (spir), mRNA 
0   NM_165323.1  CG10076-RA, transcript variant A (spir), mRNA 
0   NM_167825.1  CG1225-RC, transcript variant C (RhoGEF3), mRNA 
0   NM_167824.1  CG1225-RE, transcript variant E (RhoGEF3), mRNA 
0   NM_167823.1  CG1225-RB, transcript variant B (RhoGEF3), mRNA 
0   NM_138183.2  CG1225-RA, transcript variant A (RhoGEF3), mRNA 
0   NM_169832.1  CG7708-RB, transcript variant B (CG7708), mRNA 
0   NM_141673.4  CG31352-RA (CG31352), mRNA 
0   NM_169301.2  CG31332-RC, transcript variant C (unc-115), mRNA 
0   NM_169300.2  CG31332-RD, transcript variant D (unc-115), mRNA 
0   NM_169302.1  CG31332-RA, transcript variant A (unc-115), mRNA 
0   NM_169303.2  CG31332-RB, transcript variant B (unc-115), mRNA 
0   NM_139754.1  CG6462-RA (CG6462), mRNA 
0   NM_137772.1  CG9294-RA, transcript variant A (CG9294), mRNA 
0   NM_137892.2  CG3700-RA (CG3700), mRNA 
0   NM_141016.1  CG10587-RA (CG10587), mRNA 
0   NM_057224.3  CG4694-RA (her), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.