National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4637R-2 
 Symbol hh  Full Name hedgehog 
 CG No CG4637  Old CG No CG4637 
 Synonyms Hh, HH, anon-WO0182946.19, Mrt, hg, bar-3, l(3)neo56, bar3, bar, l(3)hh, l(3)neo57, Mir, CG4637, anon-WO0134654.19, hh 
 Accession No (Link to NCBI) NM_079735.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Im SH, Takle K, Jo J, Babcock DT, Ma Z, Xiang Y, Galko MJ.
Tachykinin acts upstream of autocrine Hedgehog signaling during nociceptive sensitization in Drosophila.
Elife (2015) 4 e10735 [ PubMed ID = 26575288 ] [ RRC reference ]

Tseng CY, Su YH, Yang SM, Lin KY, Lai CM, Rastegari E, Amartuvshin O, Cho Y, Cai Y, Hsu HJ.
Smad-Independent BMP Signaling in Somatic Cells Limits the Size of the Germline Stem Cell Pool.
Stem Cell Reports (2018) 11(3) 811-827 [ PubMed ID = 30122445 ] [ RRC reference ]

Molnar C, Ruiz-Gómez A, Martín M, Rojo-Berciano S, Mayor F, de Celis JF.
Role of the Drosophila non-visual ß-arrestin kurtz in hedgehog signalling.
PLoS Genet (2011) 7(3) e1001335 [ PubMed ID = 21437272 ] [ RRC reference ]

Sato T, Ogata J, Niki Y.
BMP and Hh signaling affects primordial germ cell division in Drosophila.
Zoolog Sci (2010) 27(10) 804-10 [ PubMed ID = 20887178 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGTGTCACCTGTCTCTCCCTG 
 Primer Seq. 3'
aatctagaggtaccATGCCGGGCCATTCGTTCATC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGTGTCACCT GTCTCTCCCT GGATGCCAAA TGCCACAGTT CCAGTTCCAG TTCCAGCTCC 
0061 AAATCCGCAG CGAGCTCCAT CTCCGCAATC CCGCAAGAAG AAACGCAAAC GATGCGCCAC 
0121 ATTGCgCATA NCGCAGCGTT GCCTCAGCAG GCTGACCTCT CTGGTGGCCC TGCTGCTGAT 
0181 CGTCTTGCCG ATGGTCTTTA GCCCGGCTCA CAGCTGCGGT CCTGGCCGAG GATTGGGTCG 
0241 TCATAGGGCG CGCAACCTGT ATCCGCTGGT CCTCAAGCAG ACAATTCCCA ATCTATCCGA 
0301 GTACACGAAC AGCGCCTCCG GACCTCTGGA GGGTGTGATC CGTCGGGATT CGCCCAAATT 
0361 CAAGGACCTC GTGCCCAACT ACAACAGGGA CATCCTTTTC CGTGACGAGG AAGGCACCGG 
0421 AGCGGATCGC TTGATGAGCA AGCGCNTGCA AGGAGAAGCT AAACGTGCTG GCCTACTCGG 
0481 TGATGAACGA ATGGCCCGGC AT 
 in silico PCR Fragment
0001 AGTGTCACCT GTCTCTCCCT GGATGCCAAA TGCCACAGTT CCAGTTCCAG TTCCAGCTCC 
0061 AAATCCGCAG CGAGCTCCAT CTCCGCAATC CCGCAAGAAG AAACGCAAAC GATGCGCCAC 
0121 ATTGCGCATA -CGCAGCGTT GCCTCAGCAG GCTGACCTCT CTGGTGGCCC TGCTGCTGAT 
0181 CGTCTTGCCG ATGGTCTTTA GCCCGGCTCA CAGCTGCGGT CCTGGCCGAG GATTGGGTCG 
0241 TCATAGGGCG CGCAACCTGT ATCCGCTGGT CCTCAAGCAG ACAATTCCCA ATCTATCCGA 
0301 GTACACGAAC AGCGCCTCCG GACCTCTGGA GGGTGTGATC CGTCGGGACT CGCCCAAATT 
0361 CAAGGACCTC GTGCCCAACT ACAACAGGGA CATCCTTTTC CGCGACGAGG AAGGCACCGG 
0421 AGCGGATCGC TTGATGAGCA AGCGC-TGCA AGGAGAAGCT AAACGTGCTG GCCTACTCGG 
0481 TGATGAACGA ATGGCCCGGC AT 
 Assemble Data

4637R-2.IR_full       1   AGTGTCACCTGTCTCTCCCTGGATGCCAAATGCCACAGTTCCAGTTCCAGTTCCAGCTCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4637R-2.in silico     1   AGTGTCACCTGTCTCTCCCTGGATGCCAAATGCCACAGTTCCAGTTCCAGTTCCAGCTCC 60


4637R-2.IR_full       61  AAATCCGCAGCGAGCTCCATCTCCGCAATCCCGCAAGAAGAAACGCAAACGATGCGCCAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4637R-2.in silico     61  AAATCCGCAGCGAGCTCCATCTCCGCAATCCCGCAAGAAGAAACGCAAACGATGCGCCAC 120


4637R-2.IR_full       121 ATTGCGCATANCGCAGCGTTGCCTCAGCAGGCTGACCTCTCTGGTGGCCCTGCTGCTGAT 180
                          |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
4637R-2.in silico     121 ATTGCGCATA-CGCAGCGTTGCCTCAGCAGGCTGACCTCTCTGGTGGCCCTGCTGCTGAT 180


4637R-2.IR_full       181 CGTCTTGCCGATGGTCTTTAGCCCGGCTCACAGCTGCGGTCCTGGCCGAGGATTGGGTCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4637R-2.in silico     181 CGTCTTGCCGATGGTCTTTAGCCCGGCTCACAGCTGCGGTCCTGGCCGAGGATTGGGTCG 240


4637R-2.IR_full       241 TCATAGGGCGCGCAACCTGTATCCGCTGGTCCTCAAGCAGACAATTCCCAATCTATCCGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4637R-2.in silico     241 TCATAGGGCGCGCAACCTGTATCCGCTGGTCCTCAAGCAGACAATTCCCAATCTATCCGA 300


4637R-2.IR_full       301 GTACACGAACAGCGCCTCCGGACCTCTGGAGGGTGTGATCCGTCGGGATTCGCCCAAATT 360
                          |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
4637R-2.in silico     301 GTACACGAACAGCGCCTCCGGACCTCTGGAGGGTGTGATCCGTCGGGACTCGCCCAAATT 360


4637R-2.IR_full       361 CAAGGACCTCGTGCCCAACTACAACAGGGACATCCTTTTCCGTGACGAGGAAGGCACCGG 420
                          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
4637R-2.in silico     361 CAAGGACCTCGTGCCCAACTACAACAGGGACATCCTTTTCCGCGACGAGGAAGGCACCGG 420


4637R-2.IR_full       421 AGCGGATCGCTTGATGAGCAAGCGCNTGCAAGGAGAAGCTAAACGTGCTGGCCTACTCGG 480
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
4637R-2.in silico     421 AGCGGATCGCTTGATGAGCAAGCGC-TGCAAGGAGAAGCTAAACGTGCTGGCCTACTCGG 480


4637R-2.IR_full       481 TGATGAACGAATGGCCCGGCAT 502
                          ||||||||||||||||||||||
4637R-2.in silico     481 TGATGAACGAATGGCCCGGCAT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  14  NM_079735.3  CG4637-RA, transcript variant A (hh), mRNA 
100   482  14  NM_001038976.1  CG4637-RB, transcript variant B (hh), mRNA 
0.82   34  72  NM_131995.1  CG15784-RA (CG15784), mRNA 
0.62   10  14  22  NM_080306.2  CG3443-RB (pcx), mRNA 
0.41   22  30  NM_167642.1  CG7893-RB, transcript variant B (vav), mRNA 
0.41   22  30  NM_133144.2  CG7893-RA, transcript variant A (vav), mRNA 
0.2   13  21  NM_206727.1  CG8544-RC, transcript variant C (sd), mRNA 
0.2   13  21  NM_078614.3  CG8544-RB, transcript variant B (sd), mRNA 
0.2   13  21  NM_167465.1  CG8544-RA, transcript variant A (sd), mRNA 
0.2   16  36  NM_080317.2  CG2647-RA (per), mRNA 
0   17  12  NM_079317.2  CG10704-RA (toe), mRNA 
0   11  NM_167119.2  CG4626-RB, transcript variant B (fz4), mRNA 
0   11  NM_078513.2  CG4626-RA, transcript variant A (fz4), mRNA 
0   11  13  NM_057361.3  CG4316-RA (Sb), mRNA 
0   NM_139409.1  CG13934-RA (CG13934), mRNA 
0   NM_136349.2  CG7863-RA (dream), mRNA 
0   12  14  NM_137443.2  CG10912-RA (CG10912), mRNA 
0   10  11  NM_136634.2  CG1975-RA (Rep2), mRNA 
0   12  NM_141458.2  CG32466-RA, transcript variant A (rn), mRNA 
0   10  NM_078536.3  CG12154-RA, transcript variant A (oc), mRNA 
0   10  NM_001014727.1  CG12154-RB, transcript variant B (oc), mRNA 
0   18  NM_058149.3  CG3352-RA (ft), mRNA 
0   NM_133091.2  CG6578-RA (phm), mRNA 
0   11  NM_132095.2  CG3918-RA (CG3918), mRNA 
0   NM_135330.1  CG7356-RA, transcript variant A (CG7356), mRNA 
0   21  NM_168748.1  CG32186-RA (CG32186), mRNA 
0   17  NM_169719.1  CG14895-RB, transcript variant B (Pak3), mRNA 
0   17  NM_142288.2  CG14895-RA, transcript variant A (Pak3), mRNA 
0   14  NM_166282.1  CG5170-RF, transcript variant F (Dp1), mRNA 
0   14  NM_206163.1  CG5170-RB, transcript variant B (Dp1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.