National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4636R-2 
 Symbol SCAR  Full Name SCAR 
 CG No CG4636  Old CG No CG4636 
 Synonyms Wave, Scar, scar, wave, l(2)k03107, WAVE, CG4636, unnamed, D-SCAR, l(2)k13811, BEST:SD02991, SCAR 
 Accession No (Link to NCBI) NM_135633.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Stephan R, Gohl C, Fleige A, Klämbt C, Bogdan S.
Membrane-targeted WAVE mediates photoreceptor axon targeting in the absence of the WAVE complex in Drosophila.
Mol. Biol. Cell (2011) 22(21) 4079-92 [ PubMed ID = 21900504 ] [ RRC reference ]

Chen XJ, Squarr AJ, Stephan R, Chen B, Higgins TE, Barry DJ, Martin MC, Rosen MK, Bogdan S, Way M.
Ena/VASP proteins cooperate with the WAVE complex to regulate the actin cytoskeleton.
Dev. Cell (2014) 30(5) 569-84 [ PubMed ID = 25203209 ] [ RRC reference ]

Perkins AD, Lee MJ, Tanentzapf G.
The systematic identification of cytoskeletal genes required for Drosophila melanogaster muscle maintenance.
Sci Data (2014) 1 140002 [ PubMed ID = 25977760 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCGCTGCCCAAACGATCCATA 
 Primer Seq. 3'
aatctagaggtaccAGCATCTCCTGTCGCCACAAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCGCTGCCCA AACGATCCAT AGAACCCGTG CATGTGGCCC GCTCCGTGTA TCAGCAGGAT 
0061 GAGCTGCAAT CCGTGGAGCT GGAGACGGTC ACCAACACCA CGCTGACGAA CATCATTCGC 
0121 CAGCTGTCCT CGCTGTCCAA GCACGCAGAG GATGTGTTCG GTGAACTGGC CCGCGACGTG 
0181 GGCAACATCG GGGATCGAGC TAACTCCCTG CAGGCGCGCA TCGATCGCCT AGCTATCAAA 
0241 GTTACCCAGC TGGACAGCAC AGTTGAGGAG GTGCCCTTGA CGGACATTAC CCGAAAGAAG 
0301 GCCTTCAAGT CGGCCAAGGT TTTTGATCAA CAGATCTTCT CGCGCGCCAC CATGCCGGCA 
0361 CCAATGATGG ACACATATGC CCAGTGCGAC AAACCGCCGC CCCTCGACAA GCTTAATGTC 
0421 TATCGAGACG ATGGCAAGGA TGGTCTTAAG TTCTACACGG ATCCGAACTA CTTCTTTGAG 
0481 TTGTGGCGAC AGGAGATGCT  
 in silico PCR Fragment
0001 CCGCTGCCCA AACGATCCAT AGAACCCGTG CATGTGGCCC GCTCCGTGTA TCAGCAGGAT 
0061 GAGCTGCAAT CCGTGGAGCT GGAGACGGTC ACCAACACCA CGCTGACGAA CATCATTCGC 
0121 CAGCTGTCCT CGCTGTCCAA GCACGCAGAG GATGTGTTCG GTGAACTGGC CCGCGACGTG 
0181 GGCAACATCG GGGATCGAGC TAACTCCCTG CAGGCGCGCA TCGATCGCCT AGCTATCAAA 
0241 GTTACCCAGC TGGACAGCAC AGTTGAGGAG GTGCCCTTGA CGGACATTAC CCGAAAGAAG 
0301 GCCTTCAAGT CGGCCAAGGT TTTTGATCAA CAGATCTTCT CGCGCGCCAC CATGCCGGCA 
0361 CCAATGATGG ACACATATGC CCAGTGCGAC AAACCGCCGC CCCTCGACAA GCTTAATGTC 
0421 TATCGAGACG ATGGCAAGGA TGGTCTTAAG TTCTACACGG ATCCGAACTA CTTCTTTGAG 
0481 TTGTGGCGAC AGGAGATGCT  
 Assemble Data

4636R-2.IR_full       1   CCGCTGCCCAAACGATCCATAGAACCCGTGCATGTGGCCCGCTCCGTGTATCAGCAGGAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4636R-2.in silico     1   CCGCTGCCCAAACGATCCATAGAACCCGTGCATGTGGCCCGCTCCGTGTATCAGCAGGAT 60


4636R-2.IR_full       61  GAGCTGCAATCCGTGGAGCTGGAGACGGTCACCAACACCACGCTGACGAACATCATTCGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4636R-2.in silico     61  GAGCTGCAATCCGTGGAGCTGGAGACGGTCACCAACACCACGCTGACGAACATCATTCGC 120


4636R-2.IR_full       121 CAGCTGTCCTCGCTGTCCAAGCACGCAGAGGATGTGTTCGGTGAACTGGCCCGCGACGTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4636R-2.in silico     121 CAGCTGTCCTCGCTGTCCAAGCACGCAGAGGATGTGTTCGGTGAACTGGCCCGCGACGTG 180


4636R-2.IR_full       181 GGCAACATCGGGGATCGAGCTAACTCCCTGCAGGCGCGCATCGATCGCCTAGCTATCAAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4636R-2.in silico     181 GGCAACATCGGGGATCGAGCTAACTCCCTGCAGGCGCGCATCGATCGCCTAGCTATCAAA 240


4636R-2.IR_full       241 GTTACCCAGCTGGACAGCACAGTTGAGGAGGTGCCCTTGACGGACATTACCCGAAAGAAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4636R-2.in silico     241 GTTACCCAGCTGGACAGCACAGTTGAGGAGGTGCCCTTGACGGACATTACCCGAAAGAAG 300


4636R-2.IR_full       301 GCCTTCAAGTCGGCCAAGGTTTTTGATCAACAGATCTTCTCGCGCGCCACCATGCCGGCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4636R-2.in silico     301 GCCTTCAAGTCGGCCAAGGTTTTTGATCAACAGATCTTCTCGCGCGCCACCATGCCGGCA 360


4636R-2.IR_full       361 CCAATGATGGACACATATGCCCAGTGCGACAAACCGCCGCCCCTCGACAAGCTTAATGTC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4636R-2.in silico     361 CCAATGATGGACACATATGCCCAGTGCGACAAACCGCCGCCCCTCGACAAGCTTAATGTC 420


4636R-2.IR_full       421 TATCGAGACGATGGCAAGGATGGTCTTAAGTTCTACACGGATCCGAACTACTTCTTTGAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4636R-2.in silico     421 TATCGAGACGATGGCAAGGATGGTCTTAAGTTCTACACGGATCCGAACTACTTCTTTGAG 480


4636R-2.IR_full       481 TTGTGGCGACAGGAGATGCT 500
                          ||||||||||||||||||||
4636R-2.in silico     481 TTGTGGCGACAGGAGATGCT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135633.2  CG4636-RA (SCAR), mRNA 
0   NM_165848.1  CG12444-RA, transcript variant A (Tango3), mRNA 
0   NM_136856.1  CG12444-RB, transcript variant B (Tango3), mRNA 
0   NM_139579.2  CG10849-RA (Sc2), mRNA 
0   NM_169463.1  CG31218-RA (CG31218), mRNA 
0   NM_166560.1  CG30271-RC (CG30271), mRNA 
0   NM_169573.1  CG12207-RA, transcript variant A (CG12207), mRNA 
0   NM_169572.1  CG12207-RC, transcript variant C (CG12207), mRNA 
0   NM_142095.2  CG12207-RB, transcript variant B (CG12207), mRNA 
0   NM_142869.3  CG4656-RA (CG4656), mRNA 
0   NM_001015398.1  CG41125-PA (CG41125), mRNA 
0   NM_132092.2  CG3869-RA, transcript variant A (Marf), mRNA 
0   NM_206634.1  CG3869-RC, transcript variant C (Marf), mRNA 
0   NM_206635.2  CG3869-RB, transcript variant B (Marf), mRNA 
0   NM_205889.1  CG31665-RB, transcript variant B (CG31665), mRNA 
0   NM_164443.1  CG31665-RA, transcript variant A (CG31665), mRNA 
0   NM_001038844.1  CG31693-RB, transcript variant B (CG31693), mRNA 
0   NM_165402.2  CG31693-RA, transcript variant A (CG31693), mRNA 
0   12  NM_140271.1  CG17826-RA (CG17826), mRNA 
0   10  NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_139965.2  CG7127-RA (exo70), mRNA 
0   NM_133034.3  CG6867-RA (CG6867), mRNA 
0   NM_166973.1  CG12206-RB, transcript variant B (CG12206), mRNA 
0   NM_130704.1  CG12206-RA, transcript variant A (CG12206), mRNA 
0   NM_001043070.1  CG34146-RA (brp), mRNA 
0   NM_166974.1  CG12206-RC, transcript variant C (CG12206), mRNA 
0   NM_135846.2  CG16884-RA (CG16884), mRNA 
0   NM_169170.1  CG1070-RC, transcript variant C (Alh), mRNA 
0   NM_079526.2  CG1070-RA, transcript variant A (Alh), mRNA 
0   NM_169172.1  CG1070-RB, transcript variant B (Alh), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.