National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4636R-1 
 Symbol SCAR  Full Name SCAR 
 CG No CG4636  Old CG No CG4636 
 Synonyms Wave, Scar, scar, wave, l(2)k03107, WAVE, CG4636, unnamed, D-SCAR, l(2)k13811, BEST:SD02991, SCAR 
 Accession No (Link to NCBI) NM_135633.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Rüder M, Nagel BM, Bogdan S.
Analysis of Cell Shape and Cell Migration of Drosophila Macrophages In Vivo.
Methods Mol. Biol. (2018) 1749 227-238 [ PubMed ID = 29526001 ] [ RRC reference ]

Stephan R, Gohl C, Fleige A, Klämbt C, Bogdan S.
Membrane-targeted WAVE mediates photoreceptor axon targeting in the absence of the WAVE complex in Drosophila.
Mol. Biol. Cell (2011) 22(21) 4079-92 [ PubMed ID = 21900504 ] [ RRC reference ]

Chen XJ, Squarr AJ, Stephan R, Chen B, Higgins TE, Barry DJ, Martin MC, Rosen MK, Bogdan S, Way M.
Ena/VASP proteins cooperate with the WAVE complex to regulate the actin cytoskeleton.
Dev. Cell (2014) 30(5) 569-84 [ PubMed ID = 25203209 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCGCTGCCCAAACGATCCATAGAACCCGTGCATGTGGCCCGCTCCGTGTATCAGCAGGAT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GAGCTGCAATCCGTGGAGCTGGAGACGGTCACCAACACCACGCTGACGAACATCATTCGC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CAGCTGTCCTCGCTGTCCAAGCACGCAGAGGATGTGTTCGGTGAACTGGCCCGCGACGTG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGCAACATCGGGGATCGAGCTAACTCCCTGCAGGCGCGCATCGATCGCCTAGCTATCAAA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GTTACCCAGCTGGACAGCACAGTTGAGGAGGTGCCCTTGACGGACATTACCCGAAAGAAG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCCTTCAAGTCGGCCAAGGTTTTTGATCAACAGATCTTCTCGCGCGCCACCATGCCGGCA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CCAATGATGGACACATATGCCCAGTGCGACAAACCGCCGCCCCTCGACAAGCTTAATGTC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TATCGAGACGATGGCAAGGATGGTCTTAAGTTCTACACGGATCCGAACTACTTCTTTGAG 480

4636R-1.IR_full       481 TTGTGGCGACAGGAGATGCT 500
                          |||||||||||||||||||| silico     481 TTGTGGCGACAGGAGATGCT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135633.2  CG4636-RA (SCAR), mRNA 
0   NM_165848.1  CG12444-RA, transcript variant A (Tango3), mRNA 
0   NM_136856.1  CG12444-RB, transcript variant B (Tango3), mRNA 
0   NM_139579.2  CG10849-RA (Sc2), mRNA 
0   NM_169463.1  CG31218-RA (CG31218), mRNA 
0   NM_166560.1  CG30271-RC (CG30271), mRNA 
0   NM_169573.1  CG12207-RA, transcript variant A (CG12207), mRNA 
0   NM_169572.1  CG12207-RC, transcript variant C (CG12207), mRNA 
0   NM_142095.2  CG12207-RB, transcript variant B (CG12207), mRNA 
0   NM_142869.3  CG4656-RA (CG4656), mRNA 
0   NM_001015398.1  CG41125-PA (CG41125), mRNA 
0   NM_132092.2  CG3869-RA, transcript variant A (Marf), mRNA 
0   NM_206634.1  CG3869-RC, transcript variant C (Marf), mRNA 
0   NM_206635.2  CG3869-RB, transcript variant B (Marf), mRNA 
0   NM_205889.1  CG31665-RB, transcript variant B (CG31665), mRNA 
0   NM_164443.1  CG31665-RA, transcript variant A (CG31665), mRNA 
0   NM_001038844.1  CG31693-RB, transcript variant B (CG31693), mRNA 
0   NM_165402.2  CG31693-RA, transcript variant A (CG31693), mRNA 
0   12  NM_140271.1  CG17826-RA (CG17826), mRNA 
0   10  NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_139965.2  CG7127-RA (exo70), mRNA 
0   NM_133034.3  CG6867-RA (CG6867), mRNA 
0   NM_166973.1  CG12206-RB, transcript variant B (CG12206), mRNA 
0   NM_130704.1  CG12206-RA, transcript variant A (CG12206), mRNA 
0   NM_001043070.1  CG34146-RA (brp), mRNA 
0   NM_166974.1  CG12206-RC, transcript variant C (CG12206), mRNA 
0   NM_135846.2  CG16884-RA (CG16884), mRNA 
0   NM_169170.1  CG1070-RC, transcript variant C (Alh), mRNA 
0   NM_079526.2  CG1070-RA, transcript variant A (Alh), mRNA 
0   NM_169172.1  CG1070-RB, transcript variant B (Alh), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.